Incidental Mutation 'R2379:Tnks1bp1'
ID248368
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Nametankyrase 1 binding protein 1
SynonymsTAB182
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2379 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85048022-85073048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85063838 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1370 (S1370G)
Ref Sequence ENSEMBL: ENSMUSP00000107232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
Predicted Effect probably benign
Transcript: ENSMUST00000048400
AA Change: S708G

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955
AA Change: S708G

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111605
AA Change: S1370G

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: S1370G

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151092
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.86
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
R7535:Tnks1bp1 UTSW 2 85063280 nonsense probably null
R7596:Tnks1bp1 UTSW 2 85062713 missense probably benign 0.14
R7680:Tnks1bp1 UTSW 2 85059241 missense probably benign 0.36
R8345:Tnks1bp1 UTSW 2 85062882 missense possibly damaging 0.86
R8413:Tnks1bp1 UTSW 2 85062278 missense probably damaging 1.00
Z1176:Tnks1bp1 UTSW 2 85063530 missense probably damaging 0.99
Z1177:Tnks1bp1 UTSW 2 85059003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGACTGGGGTGACGATCTAGG -3'
(R):5'- CAAGATGGAGAACCGTACCTG -3'

Sequencing Primer
(F):5'- ACGATCTAGGCCTGAGGAATTTG -3'
(R):5'- AGAACCGTACCTGGCTCC -3'
Posted On2014-11-11