Incidental Mutation 'R2379:Limk1'
ID248377
Institutional Source Beutler Lab
Gene Symbol Limk1
Ensembl Gene ENSMUSG00000029674
Gene NameLIM-domain containing, protein kinase
Synonyms
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2379 (G1)
Quality Score124
Status Validated
Chromosome5
Chromosomal Location134656039-134688598 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 134679481 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000015137] [ENSMUST00000111233]
Predicted Effect probably benign
Transcript: ENSMUST00000015137
SMART Domains Protein: ENSMUSP00000015137
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 24 75 5.3e-19 SMART
LIM 83 137 1.73e-9 SMART
PDZ 176 258 1.51e-9 SMART
low complexity region 266 277 N/A INTRINSIC
Pfam:Pkinase 339 604 1.7e-49 PFAM
Pfam:Pkinase_Tyr 339 604 1.5e-55 PFAM
Pfam:Kdo 345 509 2.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100641
SMART Domains Protein: ENSMUSP00000098206
Gene: ENSMUSG00000072573

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
low complexity region 48 67 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111233
SMART Domains Protein: ENSMUSP00000106864
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 23 67 2.19e-1 SMART
LIM 75 129 1.73e-9 SMART
PDZ 168 250 1.51e-9 SMART
low complexity region 258 269 N/A INTRINSIC
Pfam:Pkinase_Tyr 331 596 1.5e-56 PFAM
Pfam:Pkinase 331 597 4.7e-50 PFAM
Pfam:Kdo 339 501 1.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132027
Predicted Effect probably benign
Transcript: ENSMUST00000134093
SMART Domains Protein: ENSMUSP00000121718
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 16 60 2.19e-1 SMART
LIM 68 122 1.73e-9 SMART
PDZ 161 243 1.51e-9 SMART
low complexity region 251 262 N/A INTRINSIC
Pfam:Pkinase 324 425 3.9e-16 PFAM
Pfam:Pkinase_Tyr 324 434 5.4e-14 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: This gene encodes a member of the LIM kinase family of proteins. This protein is a serine/threonine kinase that regulates actin polymerization via phosphorylation and inactivation of the actin binding factor cofilin. This protein also stimulates axon growth and may play a role in brain development. Homozygous knockout mice for this gene exhibit reduced bone mass, abnormal neuronal morphology and altered synaptic function. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display an abnormal actin cytoskeleton in neurons of the central nervous system and structural abnormalities of the dendritic spines. Long term potentiation is altered and behavioral anomalies are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Limk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Limk1 APN 5 134657900 unclassified probably benign
IGL02029:Limk1 APN 5 134657954 nonsense probably null
IGL02211:Limk1 APN 5 134657637 missense probably damaging 1.00
IGL03000:Limk1 APN 5 134670501 missense probably damaging 0.99
extremist UTSW 5 134670441 missense probably damaging 1.00
R0046:Limk1 UTSW 5 134672761 missense probably damaging 1.00
R0046:Limk1 UTSW 5 134672761 missense probably damaging 1.00
R0058:Limk1 UTSW 5 134659871 missense probably damaging 1.00
R0058:Limk1 UTSW 5 134659871 missense probably damaging 1.00
R0071:Limk1 UTSW 5 134661391 missense probably benign 0.01
R0180:Limk1 UTSW 5 134669261 missense probably damaging 0.97
R1456:Limk1 UTSW 5 134657510 missense probably benign 0.09
R2225:Limk1 UTSW 5 134661556 splice site probably null
R2899:Limk1 UTSW 5 134688300 intron probably null
R3423:Limk1 UTSW 5 134672669 critical splice donor site probably null
R4235:Limk1 UTSW 5 134670478 missense probably benign 0.00
R4516:Limk1 UTSW 5 134676786 intron probably benign
R4566:Limk1 UTSW 5 134686683 missense probably benign 0.12
R4752:Limk1 UTSW 5 134670441 missense probably damaging 1.00
R5682:Limk1 UTSW 5 134665205 critical splice donor site probably null
R5917:Limk1 UTSW 5 134657935 missense probably damaging 1.00
R6163:Limk1 UTSW 5 134657955 missense probably damaging 1.00
R6479:Limk1 UTSW 5 134661519 utr 3 prime probably benign
R6952:Limk1 UTSW 5 134670478 missense possibly damaging 0.76
R7009:Limk1 UTSW 5 134672699 missense probably benign
R7147:Limk1 UTSW 5 134657341 missense probably benign 0.14
R7453:Limk1 UTSW 5 134669237 missense probably damaging 1.00
R7471:Limk1 UTSW 5 134657971 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCTCCAGACATGTGTCCTGG -3'
(R):5'- CATCGATGTTTGTCTAGGGCAAG -3'

Sequencing Primer
(F):5'- AGACATGTGTCCTGGCTCGG -3'
(R):5'- GGTCACAACCCTTTTGGAAGTCAC -3'
Posted On2014-11-11