Incidental Mutation 'R2379:Mcm2'
ID 248378
Institutional Source Beutler Lab
Gene Symbol Mcm2
Ensembl Gene ENSMUSG00000002870
Gene Name minichromosome maintenance complex component 2
Synonyms BM28, CDCL1, Mcmd2
MMRRC Submission 040355-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2379 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 88860456-88875762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88869990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 60 (R60C)
Ref Sequence ENSEMBL: ENSMUSP00000145295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058011] [ENSMUST00000205165]
AlphaFold P97310
Predicted Effect possibly damaging
Transcript: ENSMUST00000058011
AA Change: R204C

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061923
Gene: ENSMUSG00000002870
AA Change: R204C

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:MCM2_N 50 182 3.5e-20 PFAM
MCM 290 803 N/A SMART
Blast:MCM 816 891 3e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203172
Predicted Effect probably benign
Transcript: ENSMUST00000203935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204393
Predicted Effect probably damaging
Transcript: ENSMUST00000205165
AA Change: R60C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145295
Gene: ENSMUSG00000002870
AA Change: R60C

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Meta Mutation Damage Score 0.1633 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for non functional alleles at this locus die prematurely. There is an increased tumor incidence and abnormalities in a variety of systems in mice as they become moribund. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 T C 11: 53,299,305 (GRCm39) probably benign Het
Anpep T C 7: 79,490,966 (GRCm39) T209A probably benign Het
Asb16 A G 11: 102,163,357 (GRCm39) T116A probably benign Het
Brd10 G T 19: 29,696,275 (GRCm39) Q1140K probably benign Het
Btc A T 5: 91,524,768 (GRCm39) probably benign Het
C4b T C 17: 34,954,717 (GRCm39) D860G possibly damaging Het
Cd177 G A 7: 24,457,468 (GRCm39) T191I possibly damaging Het
Cngb1 A G 8: 95,986,758 (GRCm39) L378P probably damaging Het
Ddx60 T C 8: 62,490,122 (GRCm39) F1697S probably damaging Het
Dop1a G A 9: 86,403,138 (GRCm39) S1446N probably damaging Het
Fn1 T A 1: 71,688,443 (GRCm39) K154* probably null Het
Gm10801 G T 2: 98,494,185 (GRCm39) S109I probably benign Het
Ifi204 T A 1: 173,583,559 (GRCm39) R220* probably null Het
Limk1 A G 5: 134,708,335 (GRCm39) probably benign Het
Mms22l T A 4: 24,496,929 (GRCm39) S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 (GRCm39) R322* probably null Het
Mycbp2 T C 14: 103,412,386 (GRCm39) N2529S probably benign Het
Npr3 A G 15: 11,883,449 (GRCm39) F327L probably damaging Het
Or12j3 A T 7: 139,952,748 (GRCm39) Y258* probably null Het
Or14c41 T G 7: 86,235,400 (GRCm39) F306V probably benign Het
Or14c46 T C 7: 85,918,857 (GRCm39) T47A probably damaging Het
Or51f5 A T 7: 102,424,052 (GRCm39) H107L probably benign Het
Or5p1 T C 7: 107,916,499 (GRCm39) S133P probably benign Het
Or6c217 A T 10: 129,737,781 (GRCm39) V266E probably damaging Het
Or7e177 T C 9: 20,211,963 (GRCm39) S157P possibly damaging Het
Pld2 A T 11: 70,445,140 (GRCm39) Y580F probably benign Het
Scart2 A T 7: 139,879,682 (GRCm39) D990V probably benign Het
Sik3 A G 9: 46,066,707 (GRCm39) E162G probably damaging Het
Sla2 G A 2: 156,717,862 (GRCm39) R137C probably damaging Het
Spen T C 4: 141,244,238 (GRCm39) T266A unknown Het
Tnks1bp1 A G 2: 84,894,182 (GRCm39) S1370G probably benign Het
Usp28 A G 9: 48,914,395 (GRCm39) R99G probably null Het
Vmn2r13 T G 5: 109,319,644 (GRCm39) E445D probably benign Het
Vmn2r27 A G 6: 124,201,342 (GRCm39) I205T possibly damaging Het
Other mutations in Mcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mcm2 APN 6 88,870,383 (GRCm39) missense probably benign 0.04
IGL01082:Mcm2 APN 6 88,864,859 (GRCm39) missense probably benign 0.05
IGL01451:Mcm2 APN 6 88,868,948 (GRCm39) splice site probably benign
IGL01534:Mcm2 APN 6 88,864,700 (GRCm39) critical splice donor site probably null
IGL01670:Mcm2 APN 6 88,864,614 (GRCm39) unclassified probably benign
IGL01724:Mcm2 APN 6 88,863,044 (GRCm39) missense probably damaging 1.00
IGL01936:Mcm2 APN 6 88,868,708 (GRCm39) missense probably damaging 1.00
IGL02082:Mcm2 APN 6 88,865,218 (GRCm39) nonsense probably null
dander UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
spores UTSW 6 88,874,432 (GRCm39) missense probably benign
R0254:Mcm2 UTSW 6 88,860,998 (GRCm39) missense probably damaging 0.99
R1673:Mcm2 UTSW 6 88,869,060 (GRCm39) missense probably benign 0.12
R1740:Mcm2 UTSW 6 88,861,026 (GRCm39) missense probably damaging 1.00
R1761:Mcm2 UTSW 6 88,866,770 (GRCm39) missense possibly damaging 0.90
R1917:Mcm2 UTSW 6 88,868,785 (GRCm39) missense possibly damaging 0.88
R2250:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2307:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2308:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R2309:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3431:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3432:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3878:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3911:Mcm2 UTSW 6 88,865,234 (GRCm39) missense probably damaging 0.98
R3934:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R3936:Mcm2 UTSW 6 88,869,990 (GRCm39) missense probably damaging 0.99
R4640:Mcm2 UTSW 6 88,864,786 (GRCm39) missense possibly damaging 0.53
R4749:Mcm2 UTSW 6 88,868,973 (GRCm39) missense possibly damaging 0.95
R5267:Mcm2 UTSW 6 88,874,432 (GRCm39) missense probably benign
R5701:Mcm2 UTSW 6 88,870,073 (GRCm39) missense probably damaging 1.00
R5872:Mcm2 UTSW 6 88,861,053 (GRCm39) missense probably benign 0.05
R6118:Mcm2 UTSW 6 88,864,818 (GRCm39) missense probably damaging 1.00
R6152:Mcm2 UTSW 6 88,866,891 (GRCm39) critical splice acceptor site probably benign
R6207:Mcm2 UTSW 6 88,862,844 (GRCm39) missense probably benign 0.00
R6550:Mcm2 UTSW 6 88,863,941 (GRCm39) critical splice donor site probably null
R7184:Mcm2 UTSW 6 88,868,776 (GRCm39) missense probably damaging 1.00
R7303:Mcm2 UTSW 6 88,864,928 (GRCm39) missense probably damaging 1.00
R8069:Mcm2 UTSW 6 88,869,039 (GRCm39) missense probably damaging 1.00
R8215:Mcm2 UTSW 6 88,874,293 (GRCm39) missense probably damaging 0.98
R9121:Mcm2 UTSW 6 88,861,019 (GRCm39) missense probably benign
R9745:Mcm2 UTSW 6 88,868,729 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTGAGTTCAGTGCGGCAC -3'
(R):5'- TTTGCTACCCAAGACAGCAG -3'

Sequencing Primer
(F):5'- GCCAGCAGGATACAGAAGCC -3'
(R):5'- TACCCAAGACAGCAGCGAGG -3'
Posted On 2014-11-11