Mutagenetix > Incidental Mutations

Incidental Mutation 'R2379:Cd177'

248380

Institutional Source

Beutler Lab

Gene Symbol

Cd177

Ensembl Gene

ENSMUSG00000052212

Gene Name

CD177 antigen

Synonyms

Pdp3, 1190003K14Rik

MMRRC Submission

040355-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.533) question?

Stock #

R2379 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24743983-24760311 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24758043 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 191 (T191I)

Ref Sequence

ENSEMBL: ENSMUSP00000064934 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063956]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063956
AA Change: T191I

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000064934
Gene: ENSMUSG00000052212
AA Change: T191I

Domain	Start	End	E-Value	Type
Pfam:UPAR_LY6	134	214	3.7e-11	PFAM
Pfam:UPAR_LY6	226	300	1.2e-4	PFAM
low complexity region	301	317	N/A	INTRINSIC
Pfam:UPAR_LY6	322	400	1.5e-9	PFAM
Pfam:UPAR_LY6	511	586	9.1e-12	PFAM
Pfam:UPAR_LY6	705	782	1.4e-11	PFAM
low complexity region	795	811	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.3%

Validation Efficiency

93% (37/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating neutrophils, increased neutrophil cell death and decreased neutrophils and monocytes early after S. aureus infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	A	T	7: 140,299,769	D990V	probably benign	Het
9930021J03Rik	G	T	19: 29,718,875	Q1140K	probably benign	Het
Aff4	T	C	11: 53,408,478		probably benign	Het
Anpep	T	C	7: 79,841,218	T209A	probably benign	Het
Asb16	A	G	11: 102,272,531	T116A	probably benign	Het
Btc	A	T	5: 91,376,909		probably benign	Het
C4b	T	C	17: 34,735,743	D860G	possibly damaging	Het
Cngb1	A	G	8: 95,260,130	L378P	probably damaging	Het
Ddx60	T	C	8: 62,037,088	F1697S	probably damaging	Het
Dopey1	G	A	9: 86,521,085	S1446N	probably damaging	Het
Fn1	T	A	1: 71,649,284	K154*	probably null	Het
Gm10801	G	T	2: 98,663,840	S109I	probably benign	Het
Ifi204	T	A	1: 173,755,993	R220*	probably null	Het
Limk1	A	G	5: 134,679,481		probably benign	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Mms22l	T	A	4: 24,496,929	S8T	possibly damaging	Het
Mpp7	T	A	18: 7,403,345	R322*	probably null	Het
Mycbp2	T	C	14: 103,174,950	N2529S	probably benign	Het
Npr3	A	G	15: 11,883,363	F327L	probably damaging	Het
Olfr295	T	G	7: 86,586,192	F306V	probably benign	Het
Olfr310	T	C	7: 86,269,649	T47A	probably damaging	Het
Olfr491	T	C	7: 108,317,292	S133P	probably benign	Het
Olfr530	A	T	7: 140,372,835	Y258*	probably null	Het
Olfr561	A	T	7: 102,774,845	H107L	probably benign	Het
Olfr815	A	T	10: 129,901,912	V266E	probably damaging	Het
Olfr873	T	C	9: 20,300,667	S157P	possibly damaging	Het
Pld2	A	T	11: 70,554,314	Y580F	probably benign	Het
Sik3	A	G	9: 46,155,409	E162G	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Spen	T	C	4: 141,516,927	T266A	unknown	Het
Tnks1bp1	A	G	2: 85,063,838	S1370G	probably benign	Het
Usp28	A	G	9: 49,003,095	R99G	probably null	Het
Vmn2r13	T	G	5: 109,171,778	E445D	probably benign	Het
Vmn2r27	A	G	6: 124,224,383	I205T	possibly damaging	Het

Other mutations in Cd177

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Cd177	APN	7	24759751	missense	possibly damaging	0.59
IGL00479:Cd177	APN	7	24758015	missense	probably benign	0.05
IGL00673:Cd177	APN	7	24752017	missense	possibly damaging	0.78
IGL00913:Cd177	APN	7	24756195	missense	probably damaging	1.00
IGL01445:Cd177	APN	7	24752071	missense	possibly damaging	0.95
IGL02021:Cd177	APN	7	24745206	missense	probably benign	0.16
IGL02134:Cd177	APN	7	24752352	missense	probably benign	0.01
IGL02532:Cd177	APN	7	24745249	missense	probably benign	0.30
IGL02821:Cd177	APN	7	24744393	missense	probably damaging	1.00
IGL02821:Cd177	APN	7	24744394	missense	probably damaging	1.00
IGL02888:Cd177	APN	7	24758437	missense	probably damaging	0.99
R0506:Cd177	UTSW	7	24758356	missense	probably damaging	1.00
R0601:Cd177	UTSW	7	24752313	missense	probably benign	0.00
R0631:Cd177	UTSW	7	24756686	missense	probably benign	0.03
R0713:Cd177	UTSW	7	24744430	missense	probably benign	0.25
R1595:Cd177	UTSW	7	24744964	missense	probably benign
R1659:Cd177	UTSW	7	24746137	missense	probably damaging	1.00
R2258:Cd177	UTSW	7	24756236	missense	possibly damaging	0.73
R2260:Cd177	UTSW	7	24756236	missense	possibly damaging	0.73
R2763:Cd177	UTSW	7	24758037	missense	probably benign	0.05
R2929:Cd177	UTSW	7	24754279	nonsense	probably null
R3815:Cd177	UTSW	7	24754392	missense	probably benign	0.00
R3818:Cd177	UTSW	7	24754392	missense	probably benign	0.00
R3919:Cd177	UTSW	7	24744433	missense	probably benign	0.15
R4300:Cd177	UTSW	7	24750420	missense	possibly damaging	0.48
R4494:Cd177	UTSW	7	24752003	missense	probably benign	0.06
R4781:Cd177	UTSW	7	24750626	missense	probably damaging	1.00
R4819:Cd177	UTSW	7	24752271	missense	probably damaging	1.00
R5062:Cd177	UTSW	7	24744316	missense	probably benign	0.03
R5186:Cd177	UTSW	7	24744923	missense	probably benign	0.31
R5285:Cd177	UTSW	7	24746249	missense	probably benign	0.00
R5415:Cd177	UTSW	7	24752391	missense	probably damaging	1.00
R5577:Cd177	UTSW	7	24745137	missense	probably damaging	1.00
R5637:Cd177	UTSW	7	24756323	missense	probably benign	0.01
R5673:Cd177	UTSW	7	24750362	missense	probably damaging	1.00
R5731:Cd177	UTSW	7	24744421	missense	probably damaging	1.00
R5775:Cd177	UTSW	7	24752268	missense	probably damaging	1.00
R5840:Cd177	UTSW	7	24758070	missense	probably damaging	0.99
R5870:Cd177	UTSW	7	24756332	missense	probably benign	0.00
R5872:Cd177	UTSW	7	24752263	missense	probably null	1.00
R6148:Cd177	UTSW	7	24744273	nonsense	probably null
R6505:Cd177	UTSW	7	24744246	missense	probably benign	0.00
R6897:Cd177	UTSW	7	24745074	missense	probably benign	0.31
R7023:Cd177	UTSW	7	24759762	missense	probably benign	0.44
R7088:Cd177	UTSW	7	24745133	nonsense	probably null
R7188:Cd177	UTSW	7	24756647	missense	probably damaging	1.00
R7366:Cd177	UTSW	7	24756722	missense	probably damaging	1.00
R7744:Cd177	UTSW	7	24750375	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTGCAGACACACTCTCCAG -3'
(R):5'- AGAAATTAGGACTTGTCTCCTGC -3'

Sequencing Primer
(F):5'- GTCACCCCAAAGAGTCAGTC -3'
(R):5'- GGACTTGTCTCCTGCAGAAATTAG -3'

Posted On

2014-11-11