Incidental Mutation 'R2379:Anpep'
ID248381
Institutional Source Beutler Lab
Gene Symbol Anpep
Ensembl Gene ENSMUSG00000039062
Gene Namealanyl (membrane) aminopeptidase
Synonymsaminopeptidase N, Cd13, Apn
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2379 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79821803-79861059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79841218 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 209 (T209A)
Ref Sequence ENSEMBL: ENSMUSP00000103015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]
Predicted Effect probably benign
Transcript: ENSMUST00000049004
AA Change: T209A

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: T209A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 6.3e-142 PFAM
Pfam:Peptidase_MA_2 355 502 1.4e-21 PFAM
Pfam:ERAP1_C 618 944 2.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107392
AA Change: T209A

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: T209A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 2.5e-139 PFAM
Pfam:ERAP1_C 618 943 2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149164
Predicted Effect probably benign
Transcript: ENSMUST00000205502
Predicted Effect probably benign
Transcript: ENSMUST00000206235
Meta Mutation Damage Score 0.2254 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Anpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Anpep APN 7 79825736 missense possibly damaging 0.64
IGL00089:Anpep APN 7 79841986 missense probably damaging 1.00
IGL00767:Anpep APN 7 79840890 missense probably benign 0.00
IGL00901:Anpep APN 7 79839423 missense probably benign
IGL01919:Anpep APN 7 79825350 missense possibly damaging 0.77
IGL02049:Anpep APN 7 79835181 missense probably damaging 0.97
IGL02195:Anpep APN 7 79826685 missense probably damaging 1.00
IGL02210:Anpep APN 7 79826904 missense probably benign 0.00
IGL02584:Anpep APN 7 79825393 splice site probably benign
IGL02677:Anpep APN 7 79838730 missense probably damaging 1.00
IGL03073:Anpep APN 7 79838955 missense probably damaging 1.00
IGL03100:Anpep APN 7 79836361 missense probably benign 0.01
PIT4696001:Anpep UTSW 7 79839464 missense possibly damaging 0.85
R0329:Anpep UTSW 7 79838256 missense probably benign 0.01
R0330:Anpep UTSW 7 79838256 missense probably benign 0.01
R0619:Anpep UTSW 7 79841009 missense probably benign
R0691:Anpep UTSW 7 79839299 missense probably damaging 0.98
R1004:Anpep UTSW 7 79838256 missense probably benign 0.01
R1005:Anpep UTSW 7 79838256 missense probably benign 0.01
R1274:Anpep UTSW 7 79838256 missense probably benign 0.01
R1288:Anpep UTSW 7 79838256 missense probably benign 0.01
R1289:Anpep UTSW 7 79838256 missense probably benign 0.01
R1532:Anpep UTSW 7 79826948 nonsense probably null
R1540:Anpep UTSW 7 79838256 missense probably benign 0.01
R1574:Anpep UTSW 7 79838407 splice site probably null
R1574:Anpep UTSW 7 79838407 splice site probably null
R1618:Anpep UTSW 7 79835417 missense probably benign 0.00
R1627:Anpep UTSW 7 79842011 missense probably benign
R1693:Anpep UTSW 7 79838256 missense probably benign 0.01
R1717:Anpep UTSW 7 79838256 missense probably benign 0.01
R1745:Anpep UTSW 7 79838256 missense probably benign 0.01
R1746:Anpep UTSW 7 79838256 missense probably benign 0.01
R1748:Anpep UTSW 7 79838256 missense probably benign 0.01
R1809:Anpep UTSW 7 79841823 missense probably benign 0.01
R1901:Anpep UTSW 7 79838256 missense probably benign 0.01
R1902:Anpep UTSW 7 79838256 missense probably benign 0.01
R1903:Anpep UTSW 7 79838256 missense probably benign 0.01
R1985:Anpep UTSW 7 79840857 unclassified probably null
R2508:Anpep UTSW 7 79838291 missense possibly damaging 0.80
R3110:Anpep UTSW 7 79841972 missense probably benign 0.15
R3112:Anpep UTSW 7 79841972 missense probably benign 0.15
R3898:Anpep UTSW 7 79839225 missense probably benign 0.07
R3899:Anpep UTSW 7 79839225 missense probably benign 0.07
R3900:Anpep UTSW 7 79839225 missense probably benign 0.07
R4211:Anpep UTSW 7 79840996 nonsense probably null
R4701:Anpep UTSW 7 79839465 missense probably benign 0.16
R4716:Anpep UTSW 7 79826632 missense probably benign 0.00
R5020:Anpep UTSW 7 79833727 missense probably benign
R5042:Anpep UTSW 7 79839469 missense probably benign 0.00
R5084:Anpep UTSW 7 79826870 critical splice donor site probably null
R5319:Anpep UTSW 7 79841731 missense probably benign
R5593:Anpep UTSW 7 79842046 missense probably benign 0.04
R5778:Anpep UTSW 7 79836391 missense probably benign 0.00
R5852:Anpep UTSW 7 79838972 nonsense probably null
R5906:Anpep UTSW 7 79833675 missense probably benign
R6164:Anpep UTSW 7 79842205 missense possibly damaging 0.68
R6254:Anpep UTSW 7 79839233 missense probably damaging 1.00
R6284:Anpep UTSW 7 79825802 missense probably damaging 1.00
R6380:Anpep UTSW 7 79841896 missense probably benign 0.04
R6594:Anpep UTSW 7 79841361 intron probably null
R6746:Anpep UTSW 7 79839185 intron probably null
R6920:Anpep UTSW 7 79825349 missense probably damaging 1.00
R7060:Anpep UTSW 7 79841794 missense probably benign 0.33
R7072:Anpep UTSW 7 79835379 missense possibly damaging 0.58
R7095:Anpep UTSW 7 79842202 missense possibly damaging 0.87
R7102:Anpep UTSW 7 79836313 missense probably benign 0.00
R7178:Anpep UTSW 7 79840988 missense probably benign
R7223:Anpep UTSW 7 79825310 missense probably damaging 1.00
R7344:Anpep UTSW 7 79838650 missense possibly damaging 0.60
R7441:Anpep UTSW 7 79827644 missense possibly damaging 0.93
R7479:Anpep UTSW 7 79835370 missense probably benign 0.11
R7503:Anpep UTSW 7 79826637 missense probably damaging 1.00
R7683:Anpep UTSW 7 79839198 missense probably damaging 0.98
R7912:Anpep UTSW 7 79838426 missense probably benign 0.00
R7993:Anpep UTSW 7 79838426 missense probably benign 0.00
R8036:Anpep UTSW 7 79841898 missense probably benign 0.11
R8039:Anpep UTSW 7 79839400 critical splice donor site probably null
Z1176:Anpep UTSW 7 79827639 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATGGTGCAGGAAGGGTCTTC -3'
(R):5'- ATGGCATCTGGAAGCTTTTGTC -3'

Sequencing Primer
(F):5'- CTTCCGGATAGGGCTTGGACTC -3'
(R):5'- GAAGCTTTTGTCTCCCAAGGCAG -3'
Posted On2014-11-11