Incidental Mutation 'R2379:Olfr295'
ID248383
Institutional Source Beutler Lab
Gene Symbol Olfr295
Ensembl Gene ENSMUSG00000059319
Gene Nameolfactory receptor 295
SynonymsMOR220-1, GA_x6K02T2NHDJ-9539243-9538314
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2379 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86583862-86591128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86586192 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 306 (F306V)
Ref Sequence ENSEMBL: ENSMUSP00000150377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078447] [ENSMUST00000172965] [ENSMUST00000215365]
Predicted Effect probably benign
Transcript: ENSMUST00000078447
AA Change: F306V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077542
Gene: ENSMUSG00000059319
AA Change: F306V

DomainStartEndE-ValueType
Pfam:7tm_1 39 288 6.1e-26 PFAM
Pfam:7tm_4 137 281 2.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172965
AA Change: F306V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134371
Gene: ENSMUSG00000057067
AA Change: F306V

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.2e-46 PFAM
Pfam:7tm_1 39 288 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215365
AA Change: F306V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Olfr295
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Olfr295 APN 7 86585439 missense possibly damaging 0.91
IGL02248:Olfr295 APN 7 86586104 nonsense probably null
IGL02309:Olfr295 APN 7 86585497 missense possibly damaging 0.84
IGL02866:Olfr295 APN 7 86585693 nonsense probably null
IGL03059:Olfr295 APN 7 86585571 missense probably benign 0.00
IGL03134:Olfr295 UTSW 7 86586012 missense probably damaging 0.99
R1311:Olfr295 UTSW 7 86585953 missense probably damaging 0.96
R1777:Olfr295 UTSW 7 86586064 missense probably benign
R2259:Olfr295 UTSW 7 86585884 missense possibly damaging 0.80
R5944:Olfr295 UTSW 7 86585278 start codon destroyed probably null 1.00
R6213:Olfr295 UTSW 7 86585277 start codon destroyed probably null 1.00
R6241:Olfr295 UTSW 7 86586037 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AAAAGCCTTTTCCACCTGTGTC -3'
(R):5'- TGTGTATATAGGAGCACATGGATGG -3'

Sequencing Primer
(F):5'- ACATTATTGTGGTGTCTGTGTTTC -3'
(R):5'- CACATGGATGGGGGATGAGGTTAG -3'
Posted On2014-11-11