Mutagenetix > Incidental Mutations

Incidental Mutation 'R2379:5830411N06Rik'

248386

Institutional Source

Beutler Lab

Gene Symbol

5830411N06Rik

Ensembl Gene

ENSMUSG00000054672

Gene Name

RIKEN cDNA 5830411N06 gene

Synonyms

Scart2

MMRRC Submission

040355-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2379 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140247284-140300736 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 140299769 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 990 (D990V)

Ref Sequence

ENSEMBL: ENSMUSP00000091520 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059882

SMART Domains

Protein: ENSMUSP00000061346
Gene: ENSMUSG00000054672

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
SR	238	336	1.65e-34	SMART
SR	340	440	4.53e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000093984
AA Change: D990V

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: D990V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
SR	238	336	1.65e-34	SMART
SR	340	440	4.53e-32	SMART
SR	446	546	8.78e-30	SMART
SR	551	651	1.26e-53	SMART
SR	656	756	2.88e-16	SMART
SR	783	883	7.62e-48	SMART
transmembrane domain	903	925	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164583
AA Change: D1106V

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: D1106V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SR	29	130	1.49e-18	SMART
SR	137	233	2.53e-4	SMART
Blast:SR	291	349	5e-12	BLAST
SR	354	452	1.65e-34	SMART
SR	456	556	4.53e-32	SMART
SR	562	662	8.78e-30	SMART
SR	667	767	1.26e-53	SMART
SR	772	872	2.88e-16	SMART
SR	899	999	7.62e-48	SMART
transmembrane domain	1019	1041	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210212

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211749

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.3%

Validation Efficiency

93% (37/40)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	G	T	19: 29,718,875	Q1140K	probably benign	Het
Aff4	T	C	11: 53,408,478		probably benign	Het
Anpep	T	C	7: 79,841,218	T209A	probably benign	Het
Asb16	A	G	11: 102,272,531	T116A	probably benign	Het
Btc	A	T	5: 91,376,909		probably benign	Het
C4b	T	C	17: 34,735,743	D860G	possibly damaging	Het
Cd177	G	A	7: 24,758,043	T191I	possibly damaging	Het
Cngb1	A	G	8: 95,260,130	L378P	probably damaging	Het
Ddx60	T	C	8: 62,037,088	F1697S	probably damaging	Het
Dopey1	G	A	9: 86,521,085	S1446N	probably damaging	Het
Fn1	T	A	1: 71,649,284	K154*	probably null	Het
Gm10801	G	T	2: 98,663,840	S109I	probably benign	Het
Ifi204	T	A	1: 173,755,993	R220*	probably null	Het
Limk1	A	G	5: 134,679,481		probably benign	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Mms22l	T	A	4: 24,496,929	S8T	possibly damaging	Het
Mpp7	T	A	18: 7,403,345	R322*	probably null	Het
Mycbp2	T	C	14: 103,174,950	N2529S	probably benign	Het
Npr3	A	G	15: 11,883,363	F327L	probably damaging	Het
Olfr295	T	G	7: 86,586,192	F306V	probably benign	Het
Olfr310	T	C	7: 86,269,649	T47A	probably damaging	Het
Olfr491	T	C	7: 108,317,292	S133P	probably benign	Het
Olfr530	A	T	7: 140,372,835	Y258*	probably null	Het
Olfr561	A	T	7: 102,774,845	H107L	probably benign	Het
Olfr815	A	T	10: 129,901,912	V266E	probably damaging	Het
Olfr873	T	C	9: 20,300,667	S157P	possibly damaging	Het
Pld2	A	T	11: 70,554,314	Y580F	probably benign	Het
Sik3	A	G	9: 46,155,409	E162G	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Spen	T	C	4: 141,516,927	T266A	unknown	Het
Tnks1bp1	A	G	2: 85,063,838	S1370G	probably benign	Het
Usp28	A	G	9: 49,003,095	R99G	probably null	Het
Vmn2r13	T	G	5: 109,171,778	E445D	probably benign	Het
Vmn2r27	A	G	6: 124,224,383	I205T	possibly damaging	Het

Other mutations in 5830411N06Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:5830411N06Rik	APN	7	140294842	missense	probably damaging	0.99
IGL01101:5830411N06Rik	APN	7	140296104	missense	probably benign	0.35
IGL01120:5830411N06Rik	APN	7	140296559	missense	probably benign	0.02
IGL01958:5830411N06Rik	APN	7	140274127	missense	probably damaging	1.00
IGL02150:5830411N06Rik	APN	7	140297859	missense	possibly damaging	0.84
IGL02193:5830411N06Rik	APN	7	140249000	missense	probably benign	0.17
IGL02239:5830411N06Rik	APN	7	140295843	missense	probably damaging	1.00
IGL02335:5830411N06Rik	APN	7	140296540	missense	probably damaging	1.00
IGL02569:5830411N06Rik	APN	7	140298362	missense	probably benign	0.01
IGL02993:5830411N06Rik	APN	7	140296573	missense	probably benign	0.07
IGL03261:5830411N06Rik	APN	7	140294833	missense	probably benign	0.00
IGL03365:5830411N06Rik	APN	7	140296769	missense	probably damaging	1.00
IGL03399:5830411N06Rik	APN	7	140247956	missense	probably benign	0.00
IGL03052:5830411N06Rik	UTSW	7	140248914	missense	probably damaging	1.00
PIT4791001:5830411N06Rik	UTSW	7	140274062	missense	possibly damaging	0.53
R0021:5830411N06Rik	UTSW	7	140296397	missense	probably benign	0.15
R0021:5830411N06Rik	UTSW	7	140296397	missense	probably benign	0.15
R0347:5830411N06Rik	UTSW	7	140297854	missense	probably damaging	1.00
R0374:5830411N06Rik	UTSW	7	140248961	missense	probably damaging	1.00
R0639:5830411N06Rik	UTSW	7	140247959	missense	probably benign	0.01
R0667:5830411N06Rik	UTSW	7	140261537	missense	possibly damaging	0.73
R0789:5830411N06Rik	UTSW	7	140248220	missense	probably damaging	1.00
R0959:5830411N06Rik	UTSW	7	140294791	missense	probably damaging	1.00
R1316:5830411N06Rik	UTSW	7	140299670	missense	probably benign	0.09
R1764:5830411N06Rik	UTSW	7	140297265	missense	probably benign	0.00
R2247:5830411N06Rik	UTSW	7	140249129	missense	probably null	0.96
R4112:5830411N06Rik	UTSW	7	140298368	nonsense	probably null
R4114:5830411N06Rik	UTSW	7	140297910	missense	probably damaging	1.00
R4346:5830411N06Rik	UTSW	7	140247965	missense	probably damaging	0.97
R4836:5830411N06Rik	UTSW	7	140299108	missense	probably benign
R4956:5830411N06Rik	UTSW	7	140298362	missense	probably benign	0.00
R5208:5830411N06Rik	UTSW	7	140298036	missense	probably benign	0.00
R5571:5830411N06Rik	UTSW	7	140249123	missense	probably damaging	1.00
R5583:5830411N06Rik	UTSW	7	140296826	missense	probably damaging	1.00
R5645:5830411N06Rik	UTSW	7	140248940	missense	possibly damaging	0.95
R6183:5830411N06Rik	UTSW	7	140296034	missense	possibly damaging	0.82
R6995:5830411N06Rik	UTSW	7	140261601	missense	probably benign
R7436:5830411N06Rik	UTSW	7	140261607	missense	probably benign
R7621:5830411N06Rik	UTSW	7	140296829	missense	probably damaging	1.00
R7662:5830411N06Rik	UTSW	7	140294812	missense	possibly damaging	0.58
R7669:5830411N06Rik	UTSW	7	140296321	missense	possibly damaging	0.47
R7686:5830411N06Rik	UTSW	7	140249052	missense	probably benign	0.00
R7985:5830411N06Rik	UTSW	7	140296893	missense	probably damaging	1.00
R8330:5830411N06Rik	UTSW	7	140296318	nonsense	probably null
R8843:5830411N06Rik	UTSW	7	140249000	missense	possibly damaging	0.93
R8888:5830411N06Rik	UTSW	7	140261619	missense	possibly damaging	0.93
R8895:5830411N06Rik	UTSW	7	140261619	missense	possibly damaging	0.93
R9044:5830411N06Rik	UTSW	7	140248097	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTCTGCAGGTTCTGGAGC -3'
(R):5'- GAAGGCTCTGAAGACCATCC -3'

Sequencing Primer
(F):5'- CAGGTTCTGGAGCAGTGGC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'

Posted On

2014-11-11