Incidental Mutation 'R2379:Olfr530'
ID248387
Institutional Source Beutler Lab
Gene Symbol Olfr530
Ensembl Gene ENSMUSG00000060974
Gene Nameolfactory receptor 530
SynonymsGA_x6K02T2PBJ9-42523824-42522901, MOR252-2
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2379 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140371872-140376331 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 140372835 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 258 (Y258*)
Ref Sequence ENSEMBL: ENSMUSP00000149475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074177] [ENSMUST00000216727]
Predicted Effect probably null
Transcript: ENSMUST00000074177
AA Change: Y258*
SMART Domains Protein: ENSMUSP00000073808
Gene: ENSMUSG00000060974
AA Change: Y258*

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 4.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.8e-6 PFAM
Pfam:7tm_1 41 289 1.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211097
Predicted Effect probably null
Transcript: ENSMUST00000216727
AA Change: Y258*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Olfr530
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr530 APN 7 140373185 missense probably benign 0.01
IGL01785:Olfr530 APN 7 140373125 missense probably benign
IGL01786:Olfr530 APN 7 140373125 missense probably benign
IGL03087:Olfr530 APN 7 140373092 missense probably damaging 1.00
R0543:Olfr530 UTSW 7 140373394 missense probably benign 0.07
R0634:Olfr530 UTSW 7 140373397 missense possibly damaging 0.88
R1470:Olfr530 UTSW 7 140373113 missense probably benign 0.03
R1470:Olfr530 UTSW 7 140373113 missense probably benign 0.03
R1553:Olfr530 UTSW 7 140373038 missense probably damaging 1.00
R1702:Olfr530 UTSW 7 140372742 nonsense probably null
R1767:Olfr530 UTSW 7 140373476 missense possibly damaging 0.95
R4243:Olfr530 UTSW 7 140372944 missense probably benign 0.01
R4281:Olfr530 UTSW 7 140373472 missense probably benign 0.10
R4717:Olfr530 UTSW 7 140373415 missense probably damaging 0.99
R4923:Olfr530 UTSW 7 140373007 missense probably benign 0.11
R5763:Olfr530 UTSW 7 140373655 critical splice acceptor site probably null
R6126:Olfr530 UTSW 7 140373253 missense probably damaging 1.00
R6528:Olfr530 UTSW 7 140373441 missense possibly damaging 0.81
R7469:Olfr530 UTSW 7 140373137 missense possibly damaging 0.93
R8081:Olfr530 UTSW 7 140373059 missense probably damaging 1.00
Z1177:Olfr530 UTSW 7 140372803 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GTGCCCTACAGAGTCAGAAAAG -3'
(R):5'- TACAGACATGTTCCTGACAGGC -3'

Sequencing Primer
(F):5'- GAAGGCTTGAATGAACTTATTAGCTC -3'
(R):5'- TGTTCCTGACAGGCCTAAAC -3'
Posted On2014-11-11