Incidental Mutation 'R2379:Olfr815'
ID248394
Institutional Source Beutler Lab
Gene Symbol Olfr815
Ensembl Gene ENSMUSG00000061961
Gene Nameolfactory receptor 815
SynonymsGA_x6K02T2PULF-11581263-11580331, MOR113-3
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R2379 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129900570-129905867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129901912 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 266 (V266E)
Ref Sequence ENSEMBL: ENSMUSP00000151146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071557] [ENSMUST00000205013] [ENSMUST00000216182]
Predicted Effect probably damaging
Transcript: ENSMUST00000071557
AA Change: V272E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071488
Gene: ENSMUSG00000061961
AA Change: V272E

DomainStartEndE-ValueType
Pfam:7tm_4 35 313 4.2e-45 PFAM
Pfam:7tm_1 45 294 1.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205013
AA Change: V266E
SMART Domains Protein: ENSMUSP00000145482
Gene: ENSMUSG00000049052
AA Change: V266E

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.3e-44 PFAM
Pfam:7tm_1 39 288 4.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216182
AA Change: V266E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Olfr815
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Olfr815 APN 10 129902659 missense possibly damaging 0.94
IGL01901:Olfr815 APN 10 129901853 missense probably benign 0.19
IGL02687:Olfr815 APN 10 129902102 missense probably benign 0.00
IGL02932:Olfr815 APN 10 129902418 nonsense probably null
IGL03327:Olfr815 APN 10 129902582 missense possibly damaging 0.87
R0894:Olfr815 UTSW 10 129901882 missense probably damaging 0.97
R1299:Olfr815 UTSW 10 129902077 missense probably benign 0.32
R1544:Olfr815 UTSW 10 129902424 nonsense probably null
R1939:Olfr815 UTSW 10 129902101 missense probably damaging 0.96
R2435:Olfr815 UTSW 10 129902304 missense possibly damaging 0.52
R2566:Olfr815 UTSW 10 129902095 missense probably damaging 1.00
R2892:Olfr815 UTSW 10 129901940 missense possibly damaging 0.60
R2905:Olfr815 UTSW 10 129902400 missense possibly damaging 0.93
R4552:Olfr815 UTSW 10 129902123 missense probably benign 0.00
R6566:Olfr815 UTSW 10 129902078 missense probably benign 0.00
R6988:Olfr815 UTSW 10 129902409 missense probably damaging 0.98
R7671:Olfr815 UTSW 10 129902353 missense probably damaging 1.00
Z1088:Olfr815 UTSW 10 129902683 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATTTCCTGGAGTACTTTTAGCCTG -3'
(R):5'- ATCTTAGCTCTCATGACACTCATTG -3'

Sequencing Primer
(F):5'- GGAGTACTTTTAGCCTGTTTAATACC -3'
(R):5'- ATGCTCACATTGCCAAG -3'
Posted On2014-11-11