Incidental Mutation 'R2379:Pld2'
ID248396
Institutional Source Beutler Lab
Gene Symbol Pld2
Ensembl Gene ENSMUSG00000020828
Gene Namephospholipase D2
Synonyms
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R2379 (G1)
Quality Score184
Status Not validated
Chromosome11
Chromosomal Location70540064-70558110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70554314 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 580 (Y580F)
Ref Sequence ENSEMBL: ENSMUSP00000104197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018429] [ENSMUST00000108557]
Predicted Effect probably benign
Transcript: ENSMUST00000018429
AA Change: Y580F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018429
Gene: ENSMUSG00000020828
AA Change: Y580F

DomainStartEndE-ValueType
PX 64 192 2.12e-20 SMART
PH 203 313 4.75e-6 SMART
PLDc 437 464 8.44e-4 SMART
PLDc 751 778 4.12e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108557
AA Change: Y580F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000104197
Gene: ENSMUSG00000020828
AA Change: Y580F

DomainStartEndE-ValueType
PX 64 192 2.12e-20 SMART
PH 203 313 4.75e-6 SMART
PLDc 437 464 8.44e-4 SMART
PLDc 762 789 4.12e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179806
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: This gene is a member of the phospholipase D (PLD) superfamily. The encoded protein catalyzes the hydrolysis of phosphatidylcholine to phosphatidic acid and choline. Phosphatidic acid is an essential intracellular lipid second messenger for many signaling pathways and has been implicated in a variety of physiological processes including cytoskeletal organization and cell proliferation. A similar gene in human may also function as a guanine nucleotide exchange factor (GEF) for the small GTPase Rac2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out fail to exhibit Abeta42 suppression of LTP and show altered brain phosphatidic acid levels. Mice homozygous for a different knock-out allele show normal platelet function, hemostasis and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Pld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Pld2 APN 11 70551180 nonsense probably null
IGL01094:Pld2 APN 11 70541306 missense probably damaging 0.99
IGL01696:Pld2 APN 11 70542780 missense probably damaging 1.00
IGL02165:Pld2 APN 11 70555677 missense probably damaging 1.00
IGL02477:Pld2 APN 11 70540925 missense possibly damaging 0.60
IGL02712:Pld2 APN 11 70557079 missense probably benign 0.44
IGL03013:Pld2 APN 11 70541177 missense probably damaging 1.00
R0117:Pld2 UTSW 11 70557388 missense probably benign 0.19
R0130:Pld2 UTSW 11 70554348 missense probably benign
R0508:Pld2 UTSW 11 70552542 missense probably damaging 0.98
R0973:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R0973:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R0974:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R1907:Pld2 UTSW 11 70544184 missense probably damaging 0.99
R2087:Pld2 UTSW 11 70542960 missense probably damaging 1.00
R2181:Pld2 UTSW 11 70542989 missense possibly damaging 0.70
R3772:Pld2 UTSW 11 70544123 unclassified probably benign
R3949:Pld2 UTSW 11 70553354 missense probably benign
R4028:Pld2 UTSW 11 70554905 missense probably damaging 1.00
R4029:Pld2 UTSW 11 70554905 missense probably damaging 1.00
R4160:Pld2 UTSW 11 70541427 missense probably damaging 1.00
R4428:Pld2 UTSW 11 70541334 missense probably damaging 1.00
R4595:Pld2 UTSW 11 70542020 missense probably damaging 1.00
R4945:Pld2 UTSW 11 70555698 missense probably damaging 1.00
R5280:Pld2 UTSW 11 70552759 missense probably damaging 1.00
R5659:Pld2 UTSW 11 70557561 makesense probably null
R5773:Pld2 UTSW 11 70555932 missense probably damaging 1.00
R5900:Pld2 UTSW 11 70556062 critical splice donor site probably null
R6249:Pld2 UTSW 11 70555370 missense probably damaging 1.00
R6362:Pld2 UTSW 11 70554675 missense probably damaging 1.00
R6746:Pld2 UTSW 11 70541107 missense probably damaging 0.96
R6922:Pld2 UTSW 11 70553447 missense probably benign 0.02
R7213:Pld2 UTSW 11 70553372 missense probably benign 0.02
R7754:Pld2 UTSW 11 70552869 critical splice donor site probably null
R8122:Pld2 UTSW 11 70541433 nonsense probably null
R8383:Pld2 UTSW 11 70551429 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTGTACACGGAGTAGCTGCC -3'
(R):5'- AGGTACTCTCAGGGAAGAGC -3'

Sequencing Primer
(F):5'- AGTAGCTGCCAGGGACCTTG -3'
(R):5'- TACTCTCAGGGAAGAGCAGGGAG -3'
Posted On2014-11-11