Incidental Mutation 'R0302:Slc2a7'
ID24840
Institutional Source Beutler Lab
Gene Symbol Slc2a7
Ensembl Gene ENSMUSG00000062064
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 7
SynonymsOTTMUSG00000010396
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150148972-150168482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 150149521 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 31 (A31V)
Ref Sequence ENSEMBL: ENSMUSP00000059106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059893]
Predicted Effect probably damaging
Transcript: ENSMUST00000059893
AA Change: A31V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059106
Gene: ENSMUSG00000062064
AA Change: A31V

DomainStartEndE-ValueType
Pfam:MFS_1 22 319 2e-15 PFAM
Pfam:Sugar_tr 26 494 7.6e-120 PFAM
Meta Mutation Damage Score 0.5700 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A7 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Li et al., 2004). This family of transporters shows conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Slc2a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Slc2a7 APN 4 150157564 missense probably damaging 1.00
IGL01990:Slc2a7 APN 4 150154684 missense possibly damaging 0.89
IGL02480:Slc2a7 APN 4 150160112 missense possibly damaging 0.93
IGL02607:Slc2a7 APN 4 150154705 missense probably benign
IGL02716:Slc2a7 APN 4 150160010 splice site probably benign
IGL02861:Slc2a7 APN 4 150168379 missense probably benign 0.16
IGL03343:Slc2a7 APN 4 150168340 missense probably damaging 1.00
R0116:Slc2a7 UTSW 4 150168264 missense probably benign 0.31
R0309:Slc2a7 UTSW 4 150158071 splice site probably benign
R0367:Slc2a7 UTSW 4 150166366 missense probably benign 0.03
R1485:Slc2a7 UTSW 4 150166396 missense probably damaging 1.00
R1542:Slc2a7 UTSW 4 150168471 missense probably damaging 1.00
R1544:Slc2a7 UTSW 4 150154686 missense probably damaging 1.00
R3973:Slc2a7 UTSW 4 150158210 splice site probably null
R4399:Slc2a7 UTSW 4 150158550 missense probably damaging 1.00
R4467:Slc2a7 UTSW 4 150163274 missense possibly damaging 0.95
R4712:Slc2a7 UTSW 4 150168469 missense probably benign 0.00
R5066:Slc2a7 UTSW 4 150160116 missense probably damaging 1.00
R5510:Slc2a7 UTSW 4 150160094 missense probably benign 0.00
R5995:Slc2a7 UTSW 4 150168340 missense probably damaging 1.00
R6017:Slc2a7 UTSW 4 150165172 missense probably damaging 0.99
R6062:Slc2a7 UTSW 4 150168427 missense probably benign
R6185:Slc2a7 UTSW 4 150148993 missense probably benign 0.00
R6730:Slc2a7 UTSW 4 150158148 missense probably damaging 1.00
R7753:Slc2a7 UTSW 4 150154684 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCTGAAAACCTCTGTACGCAGATG -3'
(R):5'- AATGGCTCTAGATGCCCCTAGTCC -3'

Sequencing Primer
(F):5'- GGCCCTGGAATCAATCTATCGAG -3'
(R):5'- AGACAGCAGCTGACTTCTAC -3'
Posted On2013-04-16