Incidental Mutation 'R2379:Mpp7'
ID248403
Institutional Source Beutler Lab
Gene Symbol Mpp7
Ensembl Gene ENSMUSG00000057440
Gene Namemembrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms2810038M04Rik, LOC381166, 1110068J02Rik, 5430426E14Rik
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2379 (G1)
Quality Score209
Status Validated
Chromosome18
Chromosomal Location7347962-7626863 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 7403345 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 322 (R322*)
Ref Sequence ENSEMBL: ENSMUSP00000111535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115869]
Predicted Effect probably null
Transcript: ENSMUST00000115869
AA Change: R322*
SMART Domains Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: R322*

DomainStartEndE-ValueType
L27 10 68 7.05e-14 SMART
L27 72 125 3.72e-13 SMART
PDZ 147 220 3.8e-15 SMART
SH3 231 297 1.4e-11 SMART
low complexity region 317 328 N/A INTRINSIC
GuKc 367 563 4.01e-65 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr310 T C 7: 86,269,649 T47A probably damaging Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Mpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mpp7 APN 18 7353297 missense probably benign 0.00
IGL01575:Mpp7 APN 18 7403365 splice site probably benign
IGL02973:Mpp7 APN 18 7403297 missense probably damaging 1.00
IGL02985:Mpp7 APN 18 7461637 critical splice donor site probably null
IGL03224:Mpp7 APN 18 7403269 missense probably benign 0.28
IGL03248:Mpp7 APN 18 7403269 missense probably benign 0.28
R0040:Mpp7 UTSW 18 7403180 splice site probably benign
R0089:Mpp7 UTSW 18 7439555 splice site probably benign
R1413:Mpp7 UTSW 18 7350977 missense probably damaging 1.00
R1634:Mpp7 UTSW 18 7350984 missense possibly damaging 0.63
R1859:Mpp7 UTSW 18 7350967 makesense probably null
R2869:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2869:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3008:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3009:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3010:Mpp7 UTSW 18 7461678 missense possibly damaging 0.76
R3782:Mpp7 UTSW 18 7351085 missense probably damaging 0.99
R3980:Mpp7 UTSW 18 7444062 missense probably benign 0.23
R4574:Mpp7 UTSW 18 7353228 missense probably benign 0.02
R4772:Mpp7 UTSW 18 7379983 splice site probably null
R5066:Mpp7 UTSW 18 7513002 missense possibly damaging 0.95
R5437:Mpp7 UTSW 18 7458930 critical splice donor site probably null
R5451:Mpp7 UTSW 18 7442855 missense probably null 0.95
R5578:Mpp7 UTSW 18 7355101 missense probably benign
R5651:Mpp7 UTSW 18 7355016 critical splice donor site probably null
R5787:Mpp7 UTSW 18 7461682 missense probably benign
R6979:Mpp7 UTSW 18 7355049 missense possibly damaging 0.64
R6984:Mpp7 UTSW 18 7441623 missense probably damaging 1.00
R7448:Mpp7 UTSW 18 7351079 missense probably damaging 0.98
R7517:Mpp7 UTSW 18 7440183 nonsense probably null
R8278:Mpp7 UTSW 18 7444025 missense probably benign
R8373:Mpp7 UTSW 18 7444096 missense probably damaging 1.00
X0028:Mpp7 UTSW 18 7403273 missense probably benign 0.04
Z1177:Mpp7 UTSW 18 7355062 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGATGAAGGGAATTTTAGCTTG -3'
(R):5'- TCTCACCAGCCGTCGATATC -3'

Sequencing Primer
(F):5'- TCCTTACAAAGCAAACACTTACC -3'
(R):5'- AGCCGTCGATATCCTTTTTGAAG -3'
Posted On2014-11-11