Incidental Mutation 'R2380:Axdnd1'
ID 248409
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Name axonemal dynein light chain domain containing 1
Synonyms LOC381304, 9430070O13Rik
MMRRC Submission 040356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R2380 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 156323509-156421159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 156365651 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 655 (D655E)
Ref Sequence ENSEMBL: ENSMUSP00000148420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102782] [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000027895
Predicted Effect probably benign
Transcript: ENSMUST00000102782
SMART Domains Protein: ENSMUSP00000099843
Gene: ENSMUSG00000078193

DomainStartEndE-ValueType
Pfam:Ribosomal_L29 7 63 2.7e-22 PFAM
low complexity region 95 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177824
AA Change: D590E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: D590E

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178036
AA Change: D655E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: D655E

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179572
Predicted Effect unknown
Transcript: ENSMUST00000180173
AA Change: D458E
Predicted Effect probably benign
Transcript: ENSMUST00000213088
AA Change: D655E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 82,064,835 S978P possibly damaging Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Ampd3 C T 7: 110,800,710 T344M probably damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm C T 1: 139,479,348 A1991V probably damaging Het
Bdp1 T C 13: 100,060,370 H1169R probably benign Het
Cacna1s T C 1: 136,095,848 F942L probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Csmd1 A G 8: 16,190,087 C1104R probably damaging Het
Dhrs7c G A 11: 67,815,864 V283M probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Enpp3 T C 10: 24,776,872 E729G probably benign Het
Fam169a T A 13: 97,118,535 probably benign Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Gm8979 T C 7: 106,082,167 E627G possibly damaging Het
Hmcn1 T A 1: 150,565,384 M5374L probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Itgae A G 11: 73,145,569 E1111G probably benign Het
Kcmf1 A G 6: 72,858,772 probably null Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Lig1 T C 7: 13,303,796 probably benign Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Ncor2 A G 5: 125,036,080 V1216A possibly damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr594 A T 7: 103,220,608 T297S possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp5c A G 7: 17,006,115 Y434H probably damaging Het
Pwwp2b A G 7: 139,255,450 E269G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc35f4 A G 14: 49,306,203 probably null Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Utp6 A G 11: 79,936,005 S582P possibly damaging Het
Zbtb41 T C 1: 139,423,814 S222P probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156376663 missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156395442 missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156378389 missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156380886 missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156365689 missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156378380 critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156348960 missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156346701 missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156376544 missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156380774 splice site probably null
R2126:Axdnd1 UTSW 1 156333214 missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156392003 missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156418309 missense probably damaging 1.00
R2568:Axdnd1 UTSW 1 156392749 missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156380858 missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156419270 missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156331639 missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156376646 missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156395559 splice site probably null
R4969:Axdnd1 UTSW 1 156395505 missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156420410 missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156335350 missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156398534 missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156351412 missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156341889 missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156348958 missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156365612 splice site probably null
R6208:Axdnd1 UTSW 1 156392856 intron probably benign
R6369:Axdnd1 UTSW 1 156392745 missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156380813 missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156330962 splice site probably null
R7115:Axdnd1 UTSW 1 156380876 missense
R7203:Axdnd1 UTSW 1 156382389 missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156382477 missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156418232 critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156376516 missense
R7686:Axdnd1 UTSW 1 156395464 nonsense probably null
R7793:Axdnd1 UTSW 1 156338743 critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156392801 nonsense probably null
R7882:Axdnd1 UTSW 1 156397453 missense
R8256:Axdnd1 UTSW 1 156330666 missense unknown
R8348:Axdnd1 UTSW 1 156418284 missense probably benign 0.02
R8971:Axdnd1 UTSW 1 156391946 missense
R9207:Axdnd1 UTSW 1 156388046 missense
R9294:Axdnd1 UTSW 1 156420347 nonsense probably null
R9741:Axdnd1 UTSW 1 156341815 missense probably benign 0.18
X0009:Axdnd1 UTSW 1 156388079 missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156376535 missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156349063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTAACAGAAGGCTTTTCACTG -3'
(R):5'- AGACAAGAGAGGATCTGCCC -3'

Sequencing Primer
(F):5'- GGCTTTTCACTGTAACATACAAAGC -3'
(R):5'- AGTACCCACTGAAGAGTG -3'
Posted On 2014-11-11