Incidental Mutation 'R2380:Pmepa1'
ID248413
Institutional Source Beutler Lab
Gene Symbol Pmepa1
Ensembl Gene ENSMUSG00000038400
Gene Nameprostate transmembrane protein, androgen induced 1
SynonymsN4wbp4, Tmepai, 2210418I02Rik, PMEPA1, STAG1
MMRRC Submission 040356-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2380 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location173224458-173276533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 173228133 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 210 (R210W)
Ref Sequence ENSEMBL: ENSMUSP00000115534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036248] [ENSMUST00000139306]
Predicted Effect probably damaging
Transcript: ENSMUST00000036248
AA Change: R172W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039950
Gene: ENSMUSG00000038400
AA Change: R172W

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124124
Predicted Effect probably damaging
Transcript: ENSMUST00000139306
AA Change: R210W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115534
Gene: ENSMUSG00000038400
AA Change: R210W

DomainStartEndE-ValueType
transmembrane domain 75 97 N/A INTRINSIC
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains a Smad interacting motif (SIM). Expression of this gene is induced by androgens and transforming growth factor beta, and the encoded protein suppresses the androgen receptor and transforming growth factor beta signaling pathways though interactions with Smad proteins. Overexpression of this gene may play a role in multiple types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 82,064,835 S978P possibly damaging Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Ampd3 C T 7: 110,800,710 T344M probably damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm C T 1: 139,479,348 A1991V probably damaging Het
Axdnd1 A T 1: 156,365,651 D655E probably benign Het
Bdp1 T C 13: 100,060,370 H1169R probably benign Het
Cacna1s T C 1: 136,095,848 F942L probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Csmd1 A G 8: 16,190,087 C1104R probably damaging Het
Dhrs7c G A 11: 67,815,864 V283M probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Enpp3 T C 10: 24,776,872 E729G probably benign Het
Fam169a T A 13: 97,118,535 probably benign Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Gm8979 T C 7: 106,082,167 E627G possibly damaging Het
Hmcn1 T A 1: 150,565,384 M5374L probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Itgae A G 11: 73,145,569 E1111G probably benign Het
Kcmf1 A G 6: 72,858,772 probably null Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Lig1 T C 7: 13,303,796 probably benign Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Ncor2 A G 5: 125,036,080 V1216A possibly damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr594 A T 7: 103,220,608 T297S possibly damaging Het
Ppp5c A G 7: 17,006,115 Y434H probably damaging Het
Pwwp2b A G 7: 139,255,450 E269G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc35f4 A G 14: 49,306,203 probably null Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Utp6 A G 11: 79,936,005 S582P possibly damaging Het
Zbtb41 T C 1: 139,423,814 S222P probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Pmepa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1401:Pmepa1 UTSW 2 173228575 critical splice donor site probably null
R1439:Pmepa1 UTSW 2 173228081 missense probably benign 0.13
R1772:Pmepa1 UTSW 2 173234360 missense probably damaging 1.00
R2228:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2229:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2381:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2382:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2385:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2386:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3783:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3784:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3785:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3787:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R4600:Pmepa1 UTSW 2 173228327 missense possibly damaging 0.81
R5368:Pmepa1 UTSW 2 173228322 missense probably damaging 1.00
R5982:Pmepa1 UTSW 2 173234312 missense possibly damaging 0.82
R7371:Pmepa1 UTSW 2 173234419 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAATGACCTCGCTGTAGGTG -3'
(R):5'- TAACTCAGTCTCTGAATCTGGGG -3'

Sequencing Primer
(F):5'- GATGCCCGAGTTACTGC -3'
(R):5'- TCTCTGAATCTGGGGGAATCCAAC -3'
Posted On2014-11-11