Incidental Mutation 'R0302:Ccdc96'
ID24842
Institutional Source Beutler Lab
Gene Symbol Ccdc96
Ensembl Gene ENSMUSG00000050677
Gene Namecoiled-coil domain containing 96
Synonyms
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location36484588-36488172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36486101 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 484 (T484S)
Ref Sequence ENSEMBL: ENSMUSP00000059636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031094] [ENSMUST00000031097] [ENSMUST00000060100] [ENSMUST00000119916] [ENSMUST00000126077] [ENSMUST00000136189] [ENSMUST00000140607] [ENSMUST00000146430] [ENSMUST00000171385]
Predicted Effect probably benign
Transcript: ENSMUST00000031094
SMART Domains Protein: ENSMUSP00000031094
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031097
SMART Domains Protein: ENSMUSP00000031097
Gene: ENSMUSG00000029196

DomainStartEndE-ValueType
ZnF_ZZ 3 46 2.64e-5 SMART
SANT 66 116 1.75e-9 SMART
low complexity region 138 154 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 306 325 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000060100
AA Change: T484S

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059636
Gene: ENSMUSG00000050677
AA Change: T484S

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
SCOP:d1qbkb_ 99 144 6e-3 SMART
low complexity region 223 234 N/A INTRINSIC
coiled coil region 315 355 N/A INTRINSIC
Pfam:DUF4201 394 570 9.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119916
SMART Domains Protein: ENSMUSP00000114124
Gene: ENSMUSG00000029196

DomainStartEndE-ValueType
Blast:SANT 16 41 2e-10 BLAST
low complexity region 63 79 N/A INTRINSIC
low complexity region 158 185 N/A INTRINSIC
low complexity region 231 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126077
SMART Domains Protein: ENSMUSP00000114508
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
Blast:TBC 35 94 5e-9 BLAST
TBC 118 354 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136189
SMART Domains Protein: ENSMUSP00000115467
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 247 322 1e-32 BLAST
TBC 399 559 8.9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140607
SMART Domains Protein: ENSMUSP00000121516
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146430
SMART Domains Protein: ENSMUSP00000121816
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171385
SMART Domains Protein: ENSMUSP00000131876
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
Blast:TBC 35 94 5e-9 BLAST
TBC 118 354 1.49e-54 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Ccdc96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ccdc96 APN 5 36485080 unclassified probably benign
R0167:Ccdc96 UTSW 5 36485153 missense probably benign 0.18
R0423:Ccdc96 UTSW 5 36485247 missense probably benign 0.41
R0532:Ccdc96 UTSW 5 36486366 missense probably benign 0.18
R3800:Ccdc96 UTSW 5 36486267 missense probably damaging 1.00
R3977:Ccdc96 UTSW 5 36485166 missense possibly damaging 0.96
R4575:Ccdc96 UTSW 5 36486075 missense possibly damaging 0.88
R4720:Ccdc96 UTSW 5 36484875 unclassified probably benign
R5476:Ccdc96 UTSW 5 36485637 missense possibly damaging 0.83
R5945:Ccdc96 UTSW 5 36485850 missense probably damaging 1.00
R5995:Ccdc96 UTSW 5 36486374 missense probably damaging 0.99
R6434:Ccdc96 UTSW 5 36486363 missense probably damaging 1.00
R6493:Ccdc96 UTSW 5 36486252 missense probably damaging 0.99
R6632:Ccdc96 UTSW 5 36485189 missense probably benign 0.07
R6633:Ccdc96 UTSW 5 36485189 missense probably benign 0.07
R7395:Ccdc96 UTSW 5 36485265 missense probably benign 0.29
R7819:Ccdc96 UTSW 5 36485985 missense probably damaging 0.98
X0022:Ccdc96 UTSW 5 36486374 missense probably damaging 1.00
Z1176:Ccdc96 UTSW 5 36485594 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCAGAGCCTGGTACACTTTGAAAC -3'
(R):5'- GCGCCTGTTGAGCATTTCTGTC -3'

Sequencing Primer
(F):5'- CTGGTACACTTTGAAACCAGGATG -3'
(R):5'- GTTGAGCATTTCTGTCTTCTCCAC -3'
Posted On2013-04-16