Incidental Mutation 'R2380:Ppp5c'
ID248422
Institutional Source Beutler Lab
Gene Symbol Ppp5c
Ensembl Gene ENSMUSG00000003099
Gene Nameprotein phosphatase 5, catalytic subunit
SynonymsANP receptor, PP5
MMRRC Submission 040356-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2380 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location17004640-17027924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17006115 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 434 (Y434H)
Ref Sequence ENSEMBL: ENSMUSP00000003183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003183]
Predicted Effect probably damaging
Transcript: ENSMUST00000003183
AA Change: Y434H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003183
Gene: ENSMUSG00000003099
AA Change: Y434H

DomainStartEndE-ValueType
TPR 28 61 1.92e-6 SMART
TPR 62 95 8.29e0 SMART
TPR 96 129 4.28e-4 SMART
PP2Ac 204 480 2.8e-164 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138353
Predicted Effect unknown
Transcript: ENSMUST00000142597
AA Change: Y410H
SMART Domains Protein: ENSMUSP00000122783
Gene: ENSMUSG00000003099
AA Change: Y410H

DomainStartEndE-ValueType
TPR 27 60 1.92e-6 SMART
TPR 61 94 8.29e0 SMART
TPR 95 128 4.28e-4 SMART
PP2Ac 203 457 1.83e-145 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156366
Meta Mutation Damage Score 0.7541 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine phosphatase which is a member of the protein phosphatase catalytic subunit family. Proteins in this family participate in pathways regulated by reversible phosphorylation at serine and threonine residues; many of these pathways are involved in the regulation of cell growth and differentiation. The product of this gene has been shown to participate in signaling pathways in response to hormones or cellular stress, and elevated levels of this protein may be associated with breast cancer development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a decrease in cell cycle check-point arrest following treatment with ionizing radition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 82,064,835 S978P possibly damaging Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Ampd3 C T 7: 110,800,710 T344M probably damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm C T 1: 139,479,348 A1991V probably damaging Het
Axdnd1 A T 1: 156,365,651 D655E probably benign Het
Bdp1 T C 13: 100,060,370 H1169R probably benign Het
Cacna1s T C 1: 136,095,848 F942L probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Csmd1 A G 8: 16,190,087 C1104R probably damaging Het
Dhrs7c G A 11: 67,815,864 V283M probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Enpp3 T C 10: 24,776,872 E729G probably benign Het
Fam169a T A 13: 97,118,535 probably benign Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Gm8979 T C 7: 106,082,167 E627G possibly damaging Het
Hmcn1 T A 1: 150,565,384 M5374L probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Itgae A G 11: 73,145,569 E1111G probably benign Het
Kcmf1 A G 6: 72,858,772 probably null Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Lig1 T C 7: 13,303,796 probably benign Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Ncor2 A G 5: 125,036,080 V1216A possibly damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr594 A T 7: 103,220,608 T297S possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Pwwp2b A G 7: 139,255,450 E269G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc35f4 A G 14: 49,306,203 probably null Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Utp6 A G 11: 79,936,005 S582P possibly damaging Het
Zbtb41 T C 1: 139,423,814 S222P probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Ppp5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Ppp5c APN 7 17008630 missense possibly damaging 0.87
IGL02794:Ppp5c APN 7 17006960 missense probably benign 0.15
IGL02831:Ppp5c APN 7 17008645 missense probably damaging 1.00
IGL02950:Ppp5c APN 7 17006910 missense probably benign 0.00
Persephone UTSW 7 17022443 missense probably benign 0.01
R0078:Ppp5c UTSW 7 17027725 missense probably benign 0.09
R0366:Ppp5c UTSW 7 17022583 nonsense probably null
R1102:Ppp5c UTSW 7 17022443 missense probably benign 0.01
R1511:Ppp5c UTSW 7 17009982 missense probably damaging 1.00
R1518:Ppp5c UTSW 7 17009936 missense probably damaging 0.97
R1714:Ppp5c UTSW 7 17008703 missense probably benign 0.01
R1754:Ppp5c UTSW 7 17005310 missense probably benign 0.20
R2431:Ppp5c UTSW 7 17015425 missense probably damaging 0.99
R4854:Ppp5c UTSW 7 17009022 missense probably benign 0.00
R4974:Ppp5c UTSW 7 17009936 missense probably damaging 0.97
R5303:Ppp5c UTSW 7 17005284 missense probably benign
R5626:Ppp5c UTSW 7 17027704 missense probably benign
R5785:Ppp5c UTSW 7 17027691 critical splice donor site probably null
R6059:Ppp5c UTSW 7 17027907 unclassified probably benign
R6855:Ppp5c UTSW 7 17006966 missense possibly damaging 0.95
R7760:Ppp5c UTSW 7 17006349 missense probably damaging 1.00
R7885:Ppp5c UTSW 7 17006186 missense possibly damaging 0.86
R7922:Ppp5c UTSW 7 17027800 missense possibly damaging 0.72
R8113:Ppp5c UTSW 7 17009007 missense probably benign
R8170:Ppp5c UTSW 7 17007146 missense probably damaging 0.99
X0026:Ppp5c UTSW 7 17007110 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGTATCCTTCCTCTGGTGG -3'
(R):5'- CCAGGCCCTTATTTACCCAGAG -3'

Sequencing Primer
(F):5'- CACTACTGGGAGGCCAAGAC -3'
(R):5'- GGCCCTTATTTACCCAGAGTCTCC -3'
Posted On2014-11-11