Mutagenetix > Incidental Mutation

Incidental Mutation 'R2380:Itgae'

248435

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

CD103, alpha-E1

MMRRC Submission

040356-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2380 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73090583-73147446 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73145569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1111 (E1111G)

Ref Sequence

ENSEMBL: ENSMUSP00000006101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101]

AlphaFold

Q60677

Predicted Effect

probably benign
Transcript: ENSMUST00000006101
AA Change: E1111G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: E1111G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	T	C	15: 82,064,835	S978P	possibly damaging	Het
Ago3	G	A	4: 126,368,522	R412C	probably damaging	Het
Ampd3	C	T	7: 110,800,710	T344M	probably damaging	Het
Arl10	G	T	13: 54,575,149	V19L	probably benign	Het
Aspm	C	T	1: 139,479,348	A1991V	probably damaging	Het
Axdnd1	A	T	1: 156,365,651	D655E	probably benign	Het
Bdp1	T	C	13: 100,060,370	H1169R	probably benign	Het
Cacna1s	T	C	1: 136,095,848	F942L	probably damaging	Het
Camk2g	A	G	14: 20,739,387	I205T	probably damaging	Het
Cdh5	C	A	8: 104,125,672	H140N	possibly damaging	Het
Cog8	C	A	8: 107,056,361	G99W	probably damaging	Het
Csmd1	A	G	8: 16,190,087	C1104R	probably damaging	Het
Dhrs7c	G	A	11: 67,815,864	V283M	probably benign	Het
Emilin2	T	A	17: 71,310,224	Q64L	probably benign	Het
Enpp3	T	C	10: 24,776,872	E729G	probably benign	Het
Fam169a	T	A	13: 97,118,535		probably benign	Het
Gm7714	T	G	5: 88,282,554	M103R	probably benign	Het
Gm8979	T	C	7: 106,082,167	E627G	possibly damaging	Het
Hmcn1	T	A	1: 150,565,384	M5374L	probably benign	Het
Hsd17b1	A	T	11: 101,078,463	I8F	probably damaging	Het
Kcmf1	A	G	6: 72,858,772		probably null	Het
Kdm1b	T	A	13: 47,073,755	F574L	probably damaging	Het
Lgr4	T	C	2: 110,012,393	Y908H	probably damaging	Het
Lig1	T	C	7: 13,303,796		probably benign	Het
Ltbp3	C	A	19: 5,751,523	C698*	probably null	Het
Ncor2	A	G	5: 125,036,080	V1216A	possibly damaging	Het
Olfr1156	T	C	2: 87,949,397	T279A	probably damaging	Het
Olfr1463	T	C	19: 13,234,721	V157A	probably benign	Het
Olfr594	A	T	7: 103,220,608	T297S	possibly damaging	Het
Pmepa1	G	A	2: 173,228,133	R210W	probably damaging	Het
Ppp5c	A	G	7: 17,006,115	Y434H	probably damaging	Het
Pwwp2b	A	G	7: 139,255,450	E269G	probably damaging	Het
Rgs3	A	T	4: 62,625,887	T299S	probably benign	Het
Skint5	G	A	4: 113,546,536	T1163I	unknown	Het
Slc35f4	A	G	14: 49,306,203		probably null	Het
Trmt5	A	G	12: 73,285,114	I4T	probably benign	Het
Ttc7b	A	G	12: 100,355,001		probably null	Het
Utp6	A	G	11: 79,936,005	S582P	possibly damaging	Het
Zbtb41	T	C	1: 139,423,814	S222P	probably damaging	Het
Zfp988	A	C	4: 147,332,785	K559Q	probably benign	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73145635	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73113694	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73123148	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73119437	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73119378	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73111759	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73116137	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73118184	missense	probably benign	0.29
IGL02149:Itgae	APN	11	73103894	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73134018	missense	probably benign	0.06
IGL02231:Itgae	APN	11	73090622	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73118535	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73118121	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73130951	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73118505	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73118203	splice site	probably benign
IGL02859:Itgae	APN	11	73114867	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73125310	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73113601	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73115574	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73133854	splice site	probably null
IGL03352:Itgae	APN	11	73131730	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73111342	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73111342	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73130999	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73118147	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73123183	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73114907	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73129206	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73129206	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73138509	nonsense	probably null
R1231:Itgae	UTSW	11	73119379	missense	probably benign	0.02
R1389:Itgae	UTSW	11	73125362	missense	probably damaging	1.00
R1433:Itgae	UTSW	11	73115592	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73145605	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73117162	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73118643	splice site	probably benign
R1915:Itgae	UTSW	11	73118643	splice site	probably benign
R2061:Itgae	UTSW	11	73118622	missense	probably benign	0.00
R2435:Itgae	UTSW	11	73121937	nonsense	probably null
R2680:Itgae	UTSW	11	73114926	missense	probably damaging	1.00
R2886:Itgae	UTSW	11	73140687	missense	probably benign	0.04
R3873:Itgae	UTSW	11	73113616	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73116143	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73111339	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73112134	missense	probably benign
R4212:Itgae	UTSW	11	73119352	missense	probably benign
R4213:Itgae	UTSW	11	73119352	missense	probably benign
R4691:Itgae	UTSW	11	73119519	nonsense	probably null
R4736:Itgae	UTSW	11	73114880	missense	possibly damaging	0.79
R5152:Itgae	UTSW	11	73130995	missense	probably damaging	1.00
R5201:Itgae	UTSW	11	73110556	missense	probably benign	0.00
R5307:Itgae	UTSW	11	73145638	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73111849	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73133908	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73129248	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73145551	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73140757	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73145601	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73131693	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73111402	splice site	probably null
R6502:Itgae	UTSW	11	73145592	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73118496	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73119516	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73111369	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73116143	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73111358	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73140678	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73121960	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73113631	missense	probably damaging	1.00
R7763:Itgae	UTSW	11	73123269	critical splice donor site	probably null
R7829:Itgae	UTSW	11	73138792	missense	probably benign
R7860:Itgae	UTSW	11	73120273	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73134087	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73120384	missense	probably benign
R8911:Itgae	UTSW	11	73113621	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73125263	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73121926	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73116080	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73111803	missense	possibly damaging	0.59
R9595:Itgae	UTSW	11	73125356	missense	probably damaging	0.99
R9618:Itgae	UTSW	11	73120345	missense	possibly damaging	0.78
U15987:Itgae	UTSW	11	73115574	missense	possibly damaging	0.73
X0024:Itgae	UTSW	11	73111376	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1186:Itgae	UTSW	11	73115640	missense	probably benign
Z1186:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1187:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73115640	missense	probably benign
Z1187:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1188:Itgae	UTSW	11	73115640	missense	probably benign
Z1188:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	73115640	missense	probably benign
Z1189:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1190:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73115640	missense	probably benign
Z1190:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1191:Itgae	UTSW	11	73115640	missense	probably benign
Z1191:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73134127	missense	probably benign	0.36
Z1192:Itgae	UTSW	11	73103887	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73103960	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	73115640	missense	probably benign
Z1192:Itgae	UTSW	11	73118087	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73121931	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73121957	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73134127	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- CTGTGAAGTACGGTCGTCAT -3'
(R):5'- CGCTGGGTCTGAGGTTAGCT -3'

Sequencing Primer
(F):5'- CTCTGTCAGGGAATGGTCAGC -3'
(R):5'- GCTGTTCTCATAAGGACTGAAACC -3'

Posted On

2014-11-11