Incidental Mutation 'R2380:Trmt5'
ID248438
Institutional Source Beutler Lab
Gene Symbol Trmt5
Ensembl Gene ENSMUSG00000034442
Gene NameTRM5 tRNA methyltransferase 5
Synonyms2610027O18Rik
MMRRC Submission 040356-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R2380 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location73280011-73286710 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73285114 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 4 (I4T)
Ref Sequence ENSEMBL: ENSMUSP00000152619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058139] [ENSMUST00000101313] [ENSMUST00000116420] [ENSMUST00000122920] [ENSMUST00000126488] [ENSMUST00000140523] [ENSMUST00000153941] [ENSMUST00000220701] [ENSMUST00000221189]
Predicted Effect probably benign
Transcript: ENSMUST00000058139
SMART Domains Protein: ENSMUSP00000057153
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 122 9.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101313
SMART Domains Protein: ENSMUSP00000098871
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 1 69 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116420
AA Change: I56T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112121
Gene: ENSMUSG00000034442
AA Change: I56T

DomainStartEndE-ValueType
Pfam:Met_10 191 412 4.5e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122920
SMART Domains Protein: ENSMUSP00000124386
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 113 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126488
SMART Domains Protein: ENSMUSP00000118374
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 122 9.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140523
SMART Domains Protein: ENSMUSP00000120810
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 452 2.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153941
SMART Domains Protein: ENSMUSP00000114870
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 124 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220701
Predicted Effect probably benign
Transcript: ENSMUST00000221189
AA Change: I4T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] tRNAs contain as many as 13 or 14 nucleotides that are modified posttranscriptionally by enzymes that are highly specific for particular nucleotides in the tRNA structure. TRMT5 methylates the N1 position of guanosine-37 (G37) in selected tRNAs using S-adenosyl methionine (Brule et al., 2004 [PubMed 15248782]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 82,064,835 S978P possibly damaging Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Ampd3 C T 7: 110,800,710 T344M probably damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm C T 1: 139,479,348 A1991V probably damaging Het
Axdnd1 A T 1: 156,365,651 D655E probably benign Het
Bdp1 T C 13: 100,060,370 H1169R probably benign Het
Cacna1s T C 1: 136,095,848 F942L probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Csmd1 A G 8: 16,190,087 C1104R probably damaging Het
Dhrs7c G A 11: 67,815,864 V283M probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Enpp3 T C 10: 24,776,872 E729G probably benign Het
Fam169a T A 13: 97,118,535 probably benign Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Gm8979 T C 7: 106,082,167 E627G possibly damaging Het
Hmcn1 T A 1: 150,565,384 M5374L probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Itgae A G 11: 73,145,569 E1111G probably benign Het
Kcmf1 A G 6: 72,858,772 probably null Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Lig1 T C 7: 13,303,796 probably benign Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Ncor2 A G 5: 125,036,080 V1216A possibly damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr594 A T 7: 103,220,608 T297S possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp5c A G 7: 17,006,115 Y434H probably damaging Het
Pwwp2b A G 7: 139,255,450 E269G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc35f4 A G 14: 49,306,203 probably null Het
Ttc7b A G 12: 100,355,001 probably null Het
Utp6 A G 11: 79,936,005 S582P possibly damaging Het
Zbtb41 T C 1: 139,423,814 S222P probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Trmt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Trmt5 APN 12 73284919 missense possibly damaging 0.80
IGL01468:Trmt5 APN 12 73281104 missense probably benign 0.08
IGL01681:Trmt5 APN 12 73282603 unclassified probably benign
IGL02502:Trmt5 APN 12 73281227 missense probably benign 0.06
IGL02627:Trmt5 APN 12 73281455 missense probably damaging 1.00
IGL02688:Trmt5 APN 12 73281458 nonsense probably null
IGL03390:Trmt5 APN 12 73282727 missense probably benign 0.30
IGL03391:Trmt5 APN 12 73281452 missense probably benign 0.00
R2068:Trmt5 UTSW 12 73284670 unclassified probably null
R2239:Trmt5 UTSW 12 73285114 missense probably benign 0.00
R5169:Trmt5 UTSW 12 73282721 missense probably damaging 1.00
R5578:Trmt5 UTSW 12 73285063 unclassified probably null
R5579:Trmt5 UTSW 12 73281652 missense possibly damaging 0.92
R7390:Trmt5 UTSW 12 73281620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACATGATCAGCCTACTGTCTTC -3'
(R):5'- TCCCCAGAATCGTATGGAAGC -3'

Sequencing Primer
(F):5'- GGGATCCTCAATCACTCGC -3'
(R):5'- CCCCAGAATCGTATGGAAGCTATTTG -3'
Posted On2014-11-11