Incidental Mutation 'R0302:Slc6a12'
ID24844
Institutional Source Beutler Lab
Gene Symbol Slc6a12
Ensembl Gene ENSMUSG00000030109
Gene Namesolute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
SynonymsBGT1, Gabt2
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121343076-121365775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121363259 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 487 (D487G)
Ref Sequence ENSEMBL: ENSMUSP00000126937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032200] [ENSMUST00000163771] [ENSMUST00000165456] [ENSMUST00000166457] [ENSMUST00000171008]
Predicted Effect probably damaging
Transcript: ENSMUST00000032200
AA Change: D501G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032200
Gene: ENSMUSG00000030109
AA Change: D501G

DomainStartEndE-ValueType
Pfam:SNF 50 575 2e-242 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163771
SMART Domains Protein: ENSMUSP00000127779
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 1 128 3.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165456
SMART Domains Protein: ENSMUSP00000130715
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 1 49 3.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166457
AA Change: D487G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126937
Gene: ENSMUSG00000030109
AA Change: D487G

DomainStartEndE-ValueType
Pfam:SNF 36 561 2.5e-242 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170582
Predicted Effect possibly damaging
Transcript: ENSMUST00000171008
AA Change: D487G

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126708
Gene: ENSMUSG00000030109
AA Change: D487G

DomainStartEndE-ValueType
Pfam:SNF 36 518 1.5e-227 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171874
Meta Mutation Damage Score 0.2458 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal seizure threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Slc6a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Slc6a12 APN 6 121360455 missense probably damaging 1.00
IGL02066:Slc6a12 APN 6 121352056 missense probably damaging 0.97
IGL02146:Slc6a12 APN 6 121353501 missense probably benign 0.01
IGL02475:Slc6a12 APN 6 121354375 splice site probably null
IGL02498:Slc6a12 APN 6 121361070 missense probably benign
IGL02537:Slc6a12 APN 6 121360514 missense probably benign 0.00
IGL02696:Slc6a12 APN 6 121363252 missense probably benign 0.00
IGL03255:Slc6a12 APN 6 121354287 missense probably damaging 0.99
IGL03397:Slc6a12 APN 6 121357045 missense probably damaging 1.00
R0050:Slc6a12 UTSW 6 121360419 splice site probably benign
R0050:Slc6a12 UTSW 6 121360419 splice site probably benign
R0201:Slc6a12 UTSW 6 121355372 missense probably benign 0.03
R0255:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0317:Slc6a12 UTSW 6 121358625 missense possibly damaging 0.80
R0394:Slc6a12 UTSW 6 121346998 critical splice donor site probably null
R0492:Slc6a12 UTSW 6 121355372 missense probably benign 0.03
R0532:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0550:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0551:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R1421:Slc6a12 UTSW 6 121359126 missense probably damaging 1.00
R1487:Slc6a12 UTSW 6 121363757 nonsense probably null
R1879:Slc6a12 UTSW 6 121347423 missense probably damaging 1.00
R1905:Slc6a12 UTSW 6 121347443 nonsense probably null
R1925:Slc6a12 UTSW 6 121360526 missense probably benign 0.44
R3944:Slc6a12 UTSW 6 121354280 critical splice acceptor site probably null
R4515:Slc6a12 UTSW 6 121353530 critical splice donor site probably null
R4559:Slc6a12 UTSW 6 121363861 splice site probably null
R4628:Slc6a12 UTSW 6 121351992 nonsense probably null
R4665:Slc6a12 UTSW 6 121359013 splice site probably benign
R4753:Slc6a12 UTSW 6 121356903 splice site probably benign
R4948:Slc6a12 UTSW 6 121355322 missense probably benign 0.35
R5517:Slc6a12 UTSW 6 121354339 missense probably benign 0.10
R6717:Slc6a12 UTSW 6 121354303 missense probably benign 0.01
R7139:Slc6a12 UTSW 6 121365319 missense probably benign
R7318:Slc6a12 UTSW 6 121352013 missense probably damaging 0.99
R7318:Slc6a12 UTSW 6 121352019 missense probably benign 0.26
Z1176:Slc6a12 UTSW 6 121363827 missense probably benign
Z1177:Slc6a12 UTSW 6 121356967 missense possibly damaging 0.95
Z1177:Slc6a12 UTSW 6 121365272 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGGTAGTAGCTTTTGCCAGCAC -3'
(R):5'- CAACCACACTGAAGGGCATCTGAG -3'

Sequencing Primer
(F):5'- GGCTGCTGCTCCTCTGTG -3'
(R):5'- TGTTGAGCCATCAGTCACAG -3'
Posted On2013-04-16