Incidental Mutation 'R2380:Camk2g'
ID248444
Institutional Source Beutler Lab
Gene Symbol Camk2g
Ensembl Gene ENSMUSG00000021820
Gene Namecalcium/calmodulin-dependent protein kinase II gamma
SynonymsCaMK II, 5930429P18Rik, Camkg, Ca2+/calmodulin-dependent protein kinase II
MMRRC Submission 040356-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2380 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20734875-20794088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20739387 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 205 (I205T)
Ref Sequence ENSEMBL: ENSMUSP00000152903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071816] [ENSMUST00000080440] [ENSMUST00000100837] [ENSMUST00000223679] [ENSMUST00000223863] [ENSMUST00000224887] [ENSMUST00000225328] [ENSMUST00000225609] [ENSMUST00000226630]
Predicted Effect probably damaging
Transcript: ENSMUST00000071816
AA Change: I401T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071720
Gene: ENSMUSG00000021820
AA Change: I401T

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
low complexity region 323 338 N/A INTRINSIC
Pfam:CaMKII_AD 397 524 2.7e-62 PFAM
Pfam:DUF4440 401 514 3.9e-12 PFAM
Pfam:SnoaL_3 401 526 4.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080440
AA Change: I390T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079298
Gene: ENSMUSG00000021820
AA Change: I390T

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 386 513 3.7e-63 PFAM
Pfam:DUF4440 390 504 3.2e-14 PFAM
Pfam:SnoaL_3 390 515 4.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100837
AA Change: I367T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098398
Gene: ENSMUSG00000021820
AA Change: I367T

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 363 490 3.8e-63 PFAM
Pfam:DUF4440 367 481 3.6e-14 PFAM
Pfam:SnoaL_3 367 492 4.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223679
Predicted Effect unknown
Transcript: ENSMUST00000223712
AA Change: I210T
Predicted Effect probably damaging
Transcript: ENSMUST00000223863
AA Change: I4T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000224887
AA Change: I179T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000225328
Predicted Effect probably benign
Transcript: ENSMUST00000225463
Predicted Effect probably damaging
Transcript: ENSMUST00000225609
AA Change: I205T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225660
Predicted Effect probably damaging
Transcript: ENSMUST00000226630
AA Change: I437T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.5663 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is one of the four subunits of an enzyme which belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a gamma chain. Many alternatively spliced transcripts encoding different isoforms have been described but the full-length nature of all the variants has not been determined.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility and decreased sensitivity of macrophages to ER stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 82,064,835 S978P possibly damaging Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Ampd3 C T 7: 110,800,710 T344M probably damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm C T 1: 139,479,348 A1991V probably damaging Het
Axdnd1 A T 1: 156,365,651 D655E probably benign Het
Bdp1 T C 13: 100,060,370 H1169R probably benign Het
Cacna1s T C 1: 136,095,848 F942L probably damaging Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Csmd1 A G 8: 16,190,087 C1104R probably damaging Het
Dhrs7c G A 11: 67,815,864 V283M probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Enpp3 T C 10: 24,776,872 E729G probably benign Het
Fam169a T A 13: 97,118,535 probably benign Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Gm8979 T C 7: 106,082,167 E627G possibly damaging Het
Hmcn1 T A 1: 150,565,384 M5374L probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Itgae A G 11: 73,145,569 E1111G probably benign Het
Kcmf1 A G 6: 72,858,772 probably null Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Lig1 T C 7: 13,303,796 probably benign Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Ncor2 A G 5: 125,036,080 V1216A possibly damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr594 A T 7: 103,220,608 T297S possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp5c A G 7: 17,006,115 Y434H probably damaging Het
Pwwp2b A G 7: 139,255,450 E269G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc35f4 A G 14: 49,306,203 probably null Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Utp6 A G 11: 79,936,005 S582P possibly damaging Het
Zbtb41 T C 1: 139,423,814 S222P probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Camk2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00822:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00932:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00934:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00935:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00938:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL01151:Camk2g APN 14 20765959 missense probably damaging 1.00
IGL01578:Camk2g APN 14 20747854 splice site probably benign
IGL02749:Camk2g APN 14 20766016 critical splice acceptor site probably null
changchun UTSW 14 20742708 nonsense probably null
Jilin UTSW 14 20766212 nonsense probably null
jingyuetan UTSW 14 20793931 missense possibly damaging 0.57
Manchuria UTSW 14 20764949 missense probably damaging 1.00
F5770:Camk2g UTSW 14 20739312 splice site probably benign
R0047:Camk2g UTSW 14 20771068 splice site probably benign
R0761:Camk2g UTSW 14 20766212 nonsense probably null
R0783:Camk2g UTSW 14 20744636 missense possibly damaging 0.56
R2239:Camk2g UTSW 14 20739387 missense probably damaging 1.00
R2240:Camk2g UTSW 14 20765446 missense probably damaging 1.00
R3623:Camk2g UTSW 14 20755707 splice site probably benign
R3842:Camk2g UTSW 14 20764898 missense probably damaging 0.99
R4909:Camk2g UTSW 14 20792584 missense probably benign 0.29
R5329:Camk2g UTSW 14 20793931 missense possibly damaging 0.57
R5613:Camk2g UTSW 14 20737491 missense probably damaging 0.98
R5763:Camk2g UTSW 14 20739347 missense probably damaging 1.00
R6294:Camk2g UTSW 14 20764949 missense probably damaging 1.00
R6345:Camk2g UTSW 14 20737375 missense probably damaging 1.00
R6698:Camk2g UTSW 14 20742708 nonsense probably null
R7010:Camk2g UTSW 14 20741444 missense probably benign
R7187:Camk2g UTSW 14 20742712 missense probably benign
R7257:Camk2g UTSW 14 20747839 missense probably benign 0.01
R7459:Camk2g UTSW 14 20779207 missense probably damaging 0.97
R7655:Camk2g UTSW 14 20739342 missense possibly damaging 0.69
R7656:Camk2g UTSW 14 20739342 missense possibly damaging 0.69
Z1176:Camk2g UTSW 14 20764912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGTTTGATTCAGGCAGG -3'
(R):5'- GGAGGCAGTCCTTAACTCTTCAG -3'

Sequencing Primer
(F):5'- GGATTAAGGTCCAGACTACACTTGC -3'
(R):5'- CTTAACTCTTCAGATGCCAAAGAGGG -3'
Posted On2014-11-11