Mutagenetix > Incidental Mutation

Incidental Mutation 'R2381:Lct'

248450

Institutional Source

Beutler Lab

Gene Symbol

Lct

Ensembl Gene

ENSMUSG00000026354

Gene Name

lactase

Synonyms

LPH, LOC226413, Lphl

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2381 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128212493-128256055 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 128231858 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 664 (Q664*)

Ref Sequence

ENSEMBL: ENSMUSP00000073190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073490]

AlphaFold

F8VPT3

Predicted Effect

probably null
Transcript: ENSMUST00000073490
AA Change: Q664*

SMART Domains

Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: Q664*

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	76	226	1.6e-19	PFAM
low complexity region	322	340	N/A	INTRINSIC
Pfam:Glyco_hydro_1	380	849	4.8e-169	PFAM
low complexity region	865	875	N/A	INTRINSIC
Pfam:Glyco_hydro_1	902	1368	3.7e-181	PFAM
Pfam:Glyco_hydro_1	1377	1844	6.9e-183	PFAM
transmembrane domain	1885	1907	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cd248	G	T	19: 5,119,221 (GRCm39)	M356I	possibly damaging	Het
Cul4a	T	C	8: 13,186,887 (GRCm39)	V541A	probably benign	Het
Dnajb1	T	A	8: 84,336,971 (GRCm39)	F147Y	possibly damaging	Het
Dnhd1	A	G	7: 105,342,871 (GRCm39)	K1405R	probably benign	Het
Dpys	C	A	15: 39,705,450 (GRCm39)	R221L	probably damaging	Het
Elapor2	C	T	5: 9,430,342 (GRCm39)	P84L	probably damaging	Het
Gm12253	C	T	11: 58,326,284 (GRCm39)	R100C	probably damaging	Het
Inppl1	A	T	7: 101,478,439 (GRCm39)	S592R	probably damaging	Het
Or7g28	T	A	9: 19,271,753 (GRCm39)	E299D	probably benign	Het
Pmepa1	G	A	2: 173,069,926 (GRCm39)	R210W	probably damaging	Het
Pnpla7	A	C	2: 24,870,770 (GRCm39)	K80T	probably damaging	Het
Ppp4r3c1	T	C	X: 88,974,116 (GRCm39)	I694V	probably benign	Het
Slc4a1	T	C	11: 102,250,128 (GRCm39)	D105G	probably benign	Het
Tpo	A	G	12: 30,181,826 (GRCm39)	I23T	possibly damaging	Het
Unc5c	A	G	3: 141,383,916 (GRCm39)	E98G	probably damaging	Het
Usp13	G	A	3: 32,935,658 (GRCm39)		probably null	Het
Vmn1r175	G	A	7: 23,508,093 (GRCm39)	T178I	probably benign	Het
Zgrf1	A	T	3: 127,349,863 (GRCm39)	M15L	probably benign	Het

Other mutations in Lct

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Lct	APN	1	128,215,293 (GRCm39)	missense	probably benign	0.09
IGL00970:Lct	APN	1	128,231,805 (GRCm39)	missense	probably damaging	1.00
IGL01022:Lct	APN	1	128,228,596 (GRCm39)	missense	probably benign
IGL01878:Lct	APN	1	128,222,003 (GRCm39)	missense	probably damaging	1.00
IGL01892:Lct	APN	1	128,235,342 (GRCm39)	missense	probably damaging	1.00
IGL02307:Lct	APN	1	128,214,327 (GRCm39)	missense	possibly damaging	0.70
IGL02434:Lct	APN	1	128,231,527 (GRCm39)	missense	probably damaging	0.97
IGL02559:Lct	APN	1	128,222,003 (GRCm39)	missense	probably damaging	1.00
IGL02623:Lct	APN	1	128,235,988 (GRCm39)	missense	probably benign	0.01
IGL02818:Lct	APN	1	128,227,905 (GRCm39)	missense	probably damaging	1.00
IGL02949:Lct	APN	1	128,240,869 (GRCm39)	missense	probably benign	0.26
IGL02951:Lct	APN	1	128,227,948 (GRCm39)	missense	probably damaging	1.00
IGL03087:Lct	APN	1	128,228,112 (GRCm39)	missense	possibly damaging	0.81
IGL03227:Lct	APN	1	128,255,426 (GRCm39)	missense	probably benign	0.09
ANU18:Lct	UTSW	1	128,235,784 (GRCm39)	nonsense	probably null
R0071:Lct	UTSW	1	128,219,755 (GRCm39)	nonsense	probably null
R0071:Lct	UTSW	1	128,219,755 (GRCm39)	nonsense	probably null
R0135:Lct	UTSW	1	128,212,860 (GRCm39)	missense	probably damaging	0.98
R0145:Lct	UTSW	1	128,255,632 (GRCm39)	missense	probably benign	0.00
R0179:Lct	UTSW	1	128,255,422 (GRCm39)	missense	probably benign
R0331:Lct	UTSW	1	128,226,479 (GRCm39)	splice site	probably benign
R0366:Lct	UTSW	1	128,214,199 (GRCm39)	missense	probably benign	0.03
R0399:Lct	UTSW	1	128,228,262 (GRCm39)	missense	probably damaging	1.00
R0492:Lct	UTSW	1	128,228,319 (GRCm39)	missense	probably damaging	1.00
R0548:Lct	UTSW	1	128,212,932 (GRCm39)	missense	probably damaging	1.00
R0691:Lct	UTSW	1	128,235,971 (GRCm39)	missense	probably benign	0.00
R0755:Lct	UTSW	1	128,221,872 (GRCm39)	missense	possibly damaging	0.46
R0839:Lct	UTSW	1	128,214,346 (GRCm39)	missense	probably benign	0.00
R1128:Lct	UTSW	1	128,229,046 (GRCm39)	missense	probably damaging	0.99
R1135:Lct	UTSW	1	128,221,861 (GRCm39)	critical splice donor site	probably null
R1321:Lct	UTSW	1	128,227,759 (GRCm39)	missense	probably benign
R1448:Lct	UTSW	1	128,235,559 (GRCm39)	missense	probably damaging	0.99
R1450:Lct	UTSW	1	128,235,640 (GRCm39)	missense	probably damaging	1.00
R1572:Lct	UTSW	1	128,221,932 (GRCm39)	missense	probably benign	0.25
R1582:Lct	UTSW	1	128,228,299 (GRCm39)	missense	probably damaging	1.00
R1668:Lct	UTSW	1	128,215,459 (GRCm39)	splice site	probably null
R1757:Lct	UTSW	1	128,228,994 (GRCm39)	missense	probably damaging	1.00
R1775:Lct	UTSW	1	128,228,038 (GRCm39)	missense	probably damaging	1.00
R1792:Lct	UTSW	1	128,255,679 (GRCm39)	missense	possibly damaging	0.54
R1815:Lct	UTSW	1	128,227,896 (GRCm39)	missense	probably damaging	1.00
R1932:Lct	UTSW	1	128,221,898 (GRCm39)	missense	probably damaging	1.00
R2325:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3001:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3002:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3003:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3011:Lct	UTSW	1	128,229,109 (GRCm39)	missense	possibly damaging	0.74
R3082:Lct	UTSW	1	128,215,345 (GRCm39)	missense	probably damaging	1.00
R3683:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3684:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3726:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3886:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3887:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3888:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R4019:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R4027:Lct	UTSW	1	128,212,918 (GRCm39)	missense	probably benign	0.00
R4226:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R4409:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R4514:Lct	UTSW	1	128,228,251 (GRCm39)	missense	probably benign
R4570:Lct	UTSW	1	128,227,641 (GRCm39)	missense	probably benign	0.01
R4776:Lct	UTSW	1	128,228,124 (GRCm39)	missense	probably damaging	0.99
R5001:Lct	UTSW	1	128,235,978 (GRCm39)	missense	probably damaging	0.96
R5021:Lct	UTSW	1	128,228,302 (GRCm39)	missense	probably benign	0.38
R5318:Lct	UTSW	1	128,232,109 (GRCm39)	missense	probably damaging	1.00
R5330:Lct	UTSW	1	128,226,266 (GRCm39)	missense	probably benign	0.06
R5385:Lct	UTSW	1	128,239,354 (GRCm39)	missense	possibly damaging	0.63
R5499:Lct	UTSW	1	128,214,414 (GRCm39)	missense	probably damaging	1.00
R5508:Lct	UTSW	1	128,221,868 (GRCm39)	missense	probably damaging	1.00
R5642:Lct	UTSW	1	128,222,969 (GRCm39)	missense	probably damaging	1.00
R5724:Lct	UTSW	1	128,228,073 (GRCm39)	missense	probably benign
R6026:Lct	UTSW	1	128,227,755 (GRCm39)	missense	probably benign
R6044:Lct	UTSW	1	128,235,717 (GRCm39)	missense	possibly damaging	0.95
R6175:Lct	UTSW	1	128,255,451 (GRCm39)	missense	probably damaging	1.00
R6277:Lct	UTSW	1	128,231,974 (GRCm39)	missense	probably benign	0.01
R6412:Lct	UTSW	1	128,255,455 (GRCm39)	missense	probably benign	0.00
R6480:Lct	UTSW	1	128,222,057 (GRCm39)	missense	probably damaging	1.00
R6526:Lct	UTSW	1	128,228,215 (GRCm39)	missense	probably benign	0.05
R6620:Lct	UTSW	1	128,222,809 (GRCm39)	critical splice donor site	probably null
R7214:Lct	UTSW	1	128,228,197 (GRCm39)	missense	probably benign	0.00
R7308:Lct	UTSW	1	128,246,824 (GRCm39)	missense	probably benign	0.00
R7577:Lct	UTSW	1	128,228,469 (GRCm39)	missense	probably damaging	0.99
R7626:Lct	UTSW	1	128,212,932 (GRCm39)	missense	probably damaging	1.00
R7737:Lct	UTSW	1	128,226,430 (GRCm39)	missense	probably benign	0.12
R7901:Lct	UTSW	1	128,216,722 (GRCm39)	missense	probably benign	0.44
R8033:Lct	UTSW	1	128,212,996 (GRCm39)	missense	probably benign	0.03
R8373:Lct	UTSW	1	128,231,577 (GRCm39)	missense	probably damaging	1.00
R8504:Lct	UTSW	1	128,215,306 (GRCm39)	missense	probably damaging	1.00
R8751:Lct	UTSW	1	128,221,534 (GRCm39)	missense	probably benign	0.18
R8781:Lct	UTSW	1	128,215,261 (GRCm39)	missense	probably damaging	1.00
R8797:Lct	UTSW	1	128,231,684 (GRCm39)	missense	possibly damaging	0.77
R8926:Lct	UTSW	1	128,228,148 (GRCm39)	missense	probably damaging	1.00
R8949:Lct	UTSW	1	128,221,929 (GRCm39)	missense	probably damaging	1.00
R8992:Lct	UTSW	1	128,228,299 (GRCm39)	missense	probably damaging	1.00
R9138:Lct	UTSW	1	128,227,894 (GRCm39)	missense	probably benign	0.03
R9260:Lct	UTSW	1	128,227,704 (GRCm39)	nonsense	probably null
R9416:Lct	UTSW	1	128,228,329 (GRCm39)	missense	possibly damaging	0.74
R9531:Lct	UTSW	1	128,235,598 (GRCm39)	missense	probably benign	0.00
X0052:Lct	UTSW	1	128,235,367 (GRCm39)	missense	probably damaging	1.00
YA93:Lct	UTSW	1	128,229,057 (GRCm39)	missense	probably damaging	1.00
Z1176:Lct	UTSW	1	128,215,348 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AACCGAAGCAGCCTCCTTATG -3'
(R):5'- ATTGTGCTCAATTCAGACTGGGC -3'

Sequencing Primer
(F):5'- AGCCTCCTTATGCCCCAGG -3'
(R):5'- ACTTCATGCTAGGCTGGT -3'

Posted On

2014-11-11