Incidental Mutation 'R2381:Dnajb1'
ID248465
Institutional Source Beutler Lab
Gene Symbol Dnajb1
Ensembl Gene ENSMUSG00000005483
Gene NameDnaJ heat shock protein family (Hsp40) member B1
Synonyms0610007I11Rik, Hsp40
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2381 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location83608193-83612653 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83610342 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 147 (F147Y)
Ref Sequence ENSEMBL: ENSMUSP00000148685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005620] [ENSMUST00000212300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005620
AA Change: F247Y

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005620
Gene: ENSMUSG00000005483
AA Change: F247Y

DomainStartEndE-ValueType
DnaJ 3 60 1.07e-31 SMART
low complexity region 68 91 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:DnaJ_C 164 323 3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211972
Predicted Effect possibly damaging
Transcript: ENSMUST00000212300
AA Change: F147Y

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the DnaJ or Hsp40 (heat shock protein 40 kD) family of proteins. The encoded protein is a molecular chaperone that stimulates the ATPase activity of Hsp70 heat-shock proteins in order to promote protein folding and prevent misfolded protein aggregation. The encoded protein may also inhibit apoptosis. Peritoneal macrophages derived from homozygous knockout mice for this gene exhibit impaired heat tolerance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and overtly normal; however, homozygous null peritoneal macrophages display impaired thermotolerance in the early (but not in the late) phase after mild heat treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik T C X: 89,930,510 I694V probably benign Het
9330182L06Rik C T 5: 9,380,342 P84L probably damaging Het
Cd248 G T 19: 5,069,193 M356I possibly damaging Het
Cul4a T C 8: 13,136,887 V541A probably benign Het
Dnhd1 A G 7: 105,693,664 K1405R probably benign Het
Dpys C A 15: 39,842,054 R221L probably damaging Het
Gm12253 C T 11: 58,435,458 R100C probably damaging Het
Inppl1 A T 7: 101,829,232 S592R probably damaging Het
Lct G A 1: 128,304,121 Q664* probably null Het
Olfr846 T A 9: 19,360,457 E299D probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Pnpla7 A C 2: 24,980,758 K80T probably damaging Het
Slc4a1 T C 11: 102,359,302 D105G probably benign Het
Tpo A G 12: 30,131,827 I23T possibly damaging Het
Unc5c A G 3: 141,678,155 E98G probably damaging Het
Usp13 G A 3: 32,881,509 probably null Het
Vmn1r175 G A 7: 23,808,668 T178I probably benign Het
Zgrf1 A T 3: 127,556,214 M15L probably benign Het
Other mutations in Dnajb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03143:Dnajb1 APN 8 83608474 missense probably damaging 0.99
R5027:Dnajb1 UTSW 8 83610103 missense probably benign 0.00
R5379:Dnajb1 UTSW 8 83608506 missense possibly damaging 0.87
R7014:Dnajb1 UTSW 8 83610255 missense probably damaging 1.00
R7243:Dnajb1 UTSW 8 83610764 missense probably damaging 0.99
R7386:Dnajb1 UTSW 8 83610303 missense probably benign 0.24
R7594:Dnajb1 UTSW 8 83609844 missense probably benign
R7733:Dnajb1 UTSW 8 83608377 missense probably benign 0.11
R7852:Dnajb1 UTSW 8 83610205 missense probably benign 0.00
R7935:Dnajb1 UTSW 8 83610205 missense probably benign 0.00
R8145:Dnajb1 UTSW 8 83610315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAGATCTACAGCGGCTG -3'
(R):5'- AGAAGGGTCAGGTCTACCAG -3'

Sequencing Primer
(F):5'- GATCTACAGCGGCTGTACCAAG -3'
(R):5'- TCTACCAGACCAGGCCCG -3'
Posted On2014-11-11