Incidental Mutation 'R2395:Prss40'
ID248475
Institutional Source Beutler Lab
Gene Symbol Prss40
Ensembl Gene ENSMUSG00000037529
Gene Nameprotease, serine 40
SynonymsTesp2
MMRRC Submission 040363-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2395 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location34543968-34560943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34559905 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000045118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047840] [ENSMUST00000115071] [ENSMUST00000190790]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047840
AA Change: V59A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045118
Gene: ENSMUSG00000037529
AA Change: V59A

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Tryp_SPc 68 308 1.45e-71 SMART
low complexity region 309 319 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115071
AA Change: Y69H
SMART Domains Protein: ENSMUSP00000110723
Gene: ENSMUSG00000037529
AA Change: Y69H

DomainStartEndE-ValueType
Tryp_SPc 1 146 8.36e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190790
SMART Domains Protein: ENSMUSP00000140885
Gene: ENSMUSG00000037529

DomainStartEndE-ValueType
Tryp_SPc 4 145 2.3e-7 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,962 E622G probably benign Het
Abca8a A G 11: 110,068,788 Y707H probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Acsl3 T C 1: 78,705,368 V661A probably benign Het
B3glct A G 5: 149,754,186 T427A probably damaging Het
Cblc C A 7: 19,785,380 C341F probably damaging Het
Cntn2 T C 1: 132,526,372 S299G probably benign Het
Dcp1b T C 6: 119,215,064 S314P probably benign Het
Dnah6 T C 6: 73,091,967 probably null Het
Fam214b C A 4: 43,035,964 E256* probably null Het
Fmn1 A G 2: 113,365,181 T409A unknown Het
Hltf C T 3: 20,092,742 A555V probably benign Het
Kmt2c T C 5: 25,315,152 I1987V probably benign Het
Map3k10 T C 7: 27,673,993 E11G unknown Het
Micu1 G T 10: 59,863,202 E434* probably null Het
Mlph A G 1: 90,933,506 T288A probably benign Het
Myh13 A G 11: 67,364,922 E1679G probably benign Het
Myh15 A G 16: 49,069,514 N156S probably benign Het
Nab1 A G 1: 52,490,582 I52T probably damaging Het
Naip1 T C 13: 100,423,106 H1130R possibly damaging Het
Olfr1056 A G 2: 86,356,265 V39A probably benign Het
Olfr118 T G 17: 37,672,696 Y224* probably null Het
P2rx2 A G 5: 110,341,661 Y136H probably damaging Het
Riox1 A T 12: 83,950,644 probably null Het
Rxrb T G 17: 34,037,438 C384W probably damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Tmprss5 T A 9: 49,115,135 L373* probably null Het
Trpm2 A C 10: 77,947,880 I253S possibly damaging Het
Ush2a C T 1: 188,947,040 T4815I probably damaging Het
Vmn2r73 A T 7: 85,857,767 M779K probably damaging Het
Other mutations in Prss40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Prss40 APN 1 34552539 missense probably benign 0.01
IGL01298:Prss40 APN 1 34560766 missense probably benign
IGL01694:Prss40 APN 1 34556097 missense probably benign 0.02
IGL03030:Prss40 APN 1 34558101 missense probably damaging 0.99
IGL03393:Prss40 APN 1 34558101 missense probably damaging 0.99
R0294:Prss40 UTSW 1 34556081 missense possibly damaging 0.58
R1450:Prss40 UTSW 1 34556097 missense probably benign 0.02
R1987:Prss40 UTSW 1 34558014 missense possibly damaging 0.75
R2356:Prss40 UTSW 1 34559903 nonsense probably null
R4042:Prss40 UTSW 1 34560879 nonsense probably null
R4043:Prss40 UTSW 1 34560879 nonsense probably null
R4044:Prss40 UTSW 1 34560879 nonsense probably null
R4232:Prss40 UTSW 1 34560792 missense probably benign 0.07
R5418:Prss40 UTSW 1 34560759 missense probably benign 0.00
R5539:Prss40 UTSW 1 34552679 makesense probably null
R5719:Prss40 UTSW 1 34552517 utr 3 prime probably benign
R6365:Prss40 UTSW 1 34552517 utr 3 prime probably benign
R7002:Prss40 UTSW 1 34552400 splice site probably null
R7366:Prss40 UTSW 1 34559871 nonsense probably null
R7521:Prss40 UTSW 1 34558009 missense probably benign 0.03
R7777:Prss40 UTSW 1 34552765 nonsense probably null
R8138:Prss40 UTSW 1 34557999 missense probably damaging 0.99
R8360:Prss40 UTSW 1 34560795 missense probably benign 0.00
R8542:Prss40 UTSW 1 34557886 missense probably damaging 1.00
Z1176:Prss40 UTSW 1 34559779 missense possibly damaging 0.85
Z1177:Prss40 UTSW 1 34552586 missense probably benign 0.00
Z1177:Prss40 UTSW 1 34560819 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAACACGCACCTTTGGAAGC -3'
(R):5'- ATTTGTGAGCCTTGCTGAGAGC -3'

Sequencing Primer
(F):5'- ACCTTTGGAAGCAGTGGGC -3'
(R):5'- AGCAAGCCTTGGTCTGATC -3'
Posted On2014-11-11