Incidental Mutation 'R2395:Nab1'
ID248476
Institutional Source Beutler Lab
Gene Symbol Nab1
Ensembl Gene ENSMUSG00000002881
Gene NameNgfi-A binding protein 1
Synonyms
MMRRC Submission 040363-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2395 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location52457294-52500679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52490582 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 52 (I52T)
Ref Sequence ENSEMBL: ENSMUSP00000141191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069792] [ENSMUST00000170269] [ENSMUST00000186764]
Predicted Effect probably damaging
Transcript: ENSMUST00000069792
AA Change: I52T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066696
Gene: ENSMUSG00000002881
AA Change: I52T

DomainStartEndE-ValueType
Pfam:NCD1 5 83 1.6e-44 PFAM
low complexity region 113 122 N/A INTRINSIC
Pfam:NCD2 155 317 3.2e-68 PFAM
Pfam:Nab1 321 485 4.4e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168082
Predicted Effect probably damaging
Transcript: ENSMUST00000170269
AA Change: I52T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131239
Gene: ENSMUSG00000002881
AA Change: I52T

DomainStartEndE-ValueType
Pfam:NCD1 3 84 2.5e-50 PFAM
low complexity region 113 122 N/A INTRINSIC
Pfam:NCD2 163 319 8.4e-84 PFAM
Pfam:Nab1 333 456 9e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186764
AA Change: I52T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141191
Gene: ENSMUSG00000002881
AA Change: I52T

DomainStartEndE-ValueType
Pfam:NCD1 3 84 2.1e-46 PFAM
low complexity region 113 122 N/A INTRINSIC
Pfam:NCD2 163 319 7.1e-80 PFAM
Pfam:Nab1 321 485 9.2e-101 PFAM
Meta Mutation Damage Score 0.9219 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with normal myelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,962 E622G probably benign Het
Abca8a A G 11: 110,068,788 Y707H probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Acsl3 T C 1: 78,705,368 V661A probably benign Het
B3glct A G 5: 149,754,186 T427A probably damaging Het
Cblc C A 7: 19,785,380 C341F probably damaging Het
Cntn2 T C 1: 132,526,372 S299G probably benign Het
Dcp1b T C 6: 119,215,064 S314P probably benign Het
Dnah6 T C 6: 73,091,967 probably null Het
Fam214b C A 4: 43,035,964 E256* probably null Het
Fmn1 A G 2: 113,365,181 T409A unknown Het
Hltf C T 3: 20,092,742 A555V probably benign Het
Kmt2c T C 5: 25,315,152 I1987V probably benign Het
Map3k10 T C 7: 27,673,993 E11G unknown Het
Micu1 G T 10: 59,863,202 E434* probably null Het
Mlph A G 1: 90,933,506 T288A probably benign Het
Myh13 A G 11: 67,364,922 E1679G probably benign Het
Myh15 A G 16: 49,069,514 N156S probably benign Het
Naip1 T C 13: 100,423,106 H1130R possibly damaging Het
Olfr1056 A G 2: 86,356,265 V39A probably benign Het
Olfr118 T G 17: 37,672,696 Y224* probably null Het
P2rx2 A G 5: 110,341,661 Y136H probably damaging Het
Prss40 A G 1: 34,559,905 V59A possibly damaging Het
Riox1 A T 12: 83,950,644 probably null Het
Rxrb T G 17: 34,037,438 C384W probably damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Tmprss5 T A 9: 49,115,135 L373* probably null Het
Trpm2 A C 10: 77,947,880 I253S possibly damaging Het
Ush2a C T 1: 188,947,040 T4815I probably damaging Het
Vmn2r73 A T 7: 85,857,767 M779K probably damaging Het
Other mutations in Nab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02633:Nab1 APN 1 52490133 missense probably damaging 1.00
IGL03083:Nab1 APN 1 52490270 missense probably benign 0.02
R0464:Nab1 UTSW 1 52490015 missense possibly damaging 0.95
R1162:Nab1 UTSW 1 52490027 missense probably damaging 1.00
R4354:Nab1 UTSW 1 52490696 missense probably damaging 1.00
R6369:Nab1 UTSW 1 52490222 missense probably damaging 1.00
R6379:Nab1 UTSW 1 52480997 missense probably damaging 1.00
R6913:Nab1 UTSW 1 52464836 missense possibly damaging 0.91
R7050:Nab1 UTSW 1 52490735 start codon destroyed probably null 1.00
R7233:Nab1 UTSW 1 52459219 makesense probably null
R7378:Nab1 UTSW 1 52480995 missense probably damaging 1.00
RF003:Nab1 UTSW 1 52479282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGCTAAACTTCCCACTTC -3'
(R):5'- AGCCCATCCACAGTAATGGC -3'

Sequencing Primer
(F):5'- TATTGCAGGATATCCCCAGCCATG -3'
(R):5'- TCCACAGTAATGGCCACAG -3'
Posted On2014-11-11