Incidental Mutation 'R2395:Acsl3'
ID248477
Institutional Source Beutler Lab
Gene Symbol Acsl3
Ensembl Gene ENSMUSG00000032883
Gene Nameacyl-CoA synthetase long-chain family member 3
Synonyms2610510B12Rik, Facl3, C85929
MMRRC Submission 040363-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.584) question?
Stock #R2395 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location78657825-78707743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78705368 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 661 (V661A)
Ref Sequence ENSEMBL: ENSMUSP00000121695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000134566] [ENSMUST00000142704]
Predicted Effect probably benign
Transcript: ENSMUST00000035779
AA Change: V661A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883
AA Change: V661A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134566
AA Change: V509A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883
AA Change: V509A

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142704
AA Change: V661A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883
AA Change: V661A

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148608
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit decreased blood percentages of CD4 T cells and B cells, and a decreased IgG1 response to ovalbumin. Male mutant mice exhibit growth retardation, reduced size and reduced total tissue and lean body mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,962 E622G probably benign Het
Abca8a A G 11: 110,068,788 Y707H probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
B3glct A G 5: 149,754,186 T427A probably damaging Het
Cblc C A 7: 19,785,380 C341F probably damaging Het
Cntn2 T C 1: 132,526,372 S299G probably benign Het
Dcp1b T C 6: 119,215,064 S314P probably benign Het
Dnah6 T C 6: 73,091,967 probably null Het
Fam214b C A 4: 43,035,964 E256* probably null Het
Fmn1 A G 2: 113,365,181 T409A unknown Het
Hltf C T 3: 20,092,742 A555V probably benign Het
Kmt2c T C 5: 25,315,152 I1987V probably benign Het
Map3k10 T C 7: 27,673,993 E11G unknown Het
Micu1 G T 10: 59,863,202 E434* probably null Het
Mlph A G 1: 90,933,506 T288A probably benign Het
Myh13 A G 11: 67,364,922 E1679G probably benign Het
Myh15 A G 16: 49,069,514 N156S probably benign Het
Nab1 A G 1: 52,490,582 I52T probably damaging Het
Naip1 T C 13: 100,423,106 H1130R possibly damaging Het
Olfr1056 A G 2: 86,356,265 V39A probably benign Het
Olfr118 T G 17: 37,672,696 Y224* probably null Het
P2rx2 A G 5: 110,341,661 Y136H probably damaging Het
Prss40 A G 1: 34,559,905 V59A possibly damaging Het
Riox1 A T 12: 83,950,644 probably null Het
Rxrb T G 17: 34,037,438 C384W probably damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Tmprss5 T A 9: 49,115,135 L373* probably null Het
Trpm2 A C 10: 77,947,880 I253S possibly damaging Het
Ush2a C T 1: 188,947,040 T4815I probably damaging Het
Vmn2r73 A T 7: 85,857,767 M779K probably damaging Het
Other mutations in Acsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsl3 APN 1 78699759 missense possibly damaging 0.79
IGL02201:Acsl3 APN 1 78699153 missense probably damaging 1.00
IGL03162:Acsl3 APN 1 78699170 critical splice donor site probably null
R0601:Acsl3 UTSW 1 78696179 missense probably damaging 1.00
R0658:Acsl3 UTSW 1 78701287 missense probably damaging 1.00
R1389:Acsl3 UTSW 1 78688282 missense probably benign
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1697:Acsl3 UTSW 1 78705397 splice site probably benign
R2083:Acsl3 UTSW 1 78699811 missense probably damaging 0.99
R2125:Acsl3 UTSW 1 78681961 missense probably damaging 0.97
R2191:Acsl3 UTSW 1 78699140 missense probably damaging 1.00
R2299:Acsl3 UTSW 1 78699110 missense probably damaging 1.00
R2964:Acsl3 UTSW 1 78694294 missense probably benign 0.01
R3403:Acsl3 UTSW 1 78696122 missense probably damaging 1.00
R4655:Acsl3 UTSW 1 78690346 missense probably damaging 1.00
R5537:Acsl3 UTSW 1 78706356 missense probably damaging 1.00
R5823:Acsl3 UTSW 1 78688286 missense probably benign
R6239:Acsl3 UTSW 1 78696465 missense probably benign 0.00
R6376:Acsl3 UTSW 1 78696465 missense possibly damaging 0.81
R6650:Acsl3 UTSW 1 78681922 missense probably benign 0.03
R7031:Acsl3 UTSW 1 78688283 missense probably benign
R7282:Acsl3 UTSW 1 78681992 missense probably damaging 0.97
R7733:Acsl3 UTSW 1 78688236 critical splice acceptor site probably null
R7891:Acsl3 UTSW 1 78703588 missense probably benign 0.02
R7974:Acsl3 UTSW 1 78703588 missense probably benign 0.02
R7998:Acsl3 UTSW 1 78694271 missense probably damaging 1.00
R8056:Acsl3 UTSW 1 78681894 missense probably damaging 1.00
X0025:Acsl3 UTSW 1 78692202 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTGGCTATAGAGTGCTAAGACG -3'
(R):5'- CAGTTTAGAAGATACTGCATGCTCTAC -3'

Sequencing Primer
(F):5'- AAGCGCAGTACGTGTTAACTTTG -3'
(R):5'- TACTGCATGCTCTACAGAAGG -3'
Posted On2014-11-11