Incidental Mutation 'R2395:Mlph'
ID248478
Institutional Source Beutler Lab
Gene Symbol Mlph
Ensembl Gene ENSMUSG00000026303
Gene Namemelanophilin
Synonymsl1Rk3, l(1)-3Rk, D1Wsu84e, Slac-2a
MMRRC Submission 040363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R2395 (G1)
Quality Score188
Status Validated
Chromosome1
Chromosomal Location90915085-90951142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90933506 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 288 (T288A)
Ref Sequence ENSEMBL: ENSMUSP00000027528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027528]
Predicted Effect probably benign
Transcript: ENSMUST00000027528
AA Change: T288A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027528
Gene: ENSMUSG00000026303
AA Change: T288A

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 2e-51 PFAM
low complexity region 147 160 N/A INTRINSIC
PDB:4KP3|F 170 208 1e-18 PDB
low complexity region 379 406 N/A INTRINSIC
Pfam:Rab_eff_C 437 501 1e-15 PFAM
Meta Mutation Damage Score 0.0774 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the exophilin subfamily of Rab effector proteins. The protein forms a ternary complex with the small Ras-related GTPase Rab27A in its GTP-bound form and the motor protein myosin Va. A similar protein complex in mouse functions to tether pigment-producing organelles called melanosomes to the actin cytoskeleton in melanocytes, and is required for visible pigmentation in the hair and skin. A mutation in this gene results in Griscelli syndrome type 3, which is characterized by a silver-gray hair color and abnormal pigment distribution in the hair shaft. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous targeted null mutants affect viability and body size, and result in abnormal lungs, kidneys, immune system, hematopoiesis, myelopoiesis, and anomalies in cerebellar foliation and neuronal cell layer development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,962 E622G probably benign Het
Abca8a A G 11: 110,068,788 Y707H probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Acsl3 T C 1: 78,705,368 V661A probably benign Het
B3glct A G 5: 149,754,186 T427A probably damaging Het
Cblc C A 7: 19,785,380 C341F probably damaging Het
Cntn2 T C 1: 132,526,372 S299G probably benign Het
Dcp1b T C 6: 119,215,064 S314P probably benign Het
Dnah6 T C 6: 73,091,967 probably null Het
Fam214b C A 4: 43,035,964 E256* probably null Het
Fmn1 A G 2: 113,365,181 T409A unknown Het
Hltf C T 3: 20,092,742 A555V probably benign Het
Kmt2c T C 5: 25,315,152 I1987V probably benign Het
Map3k10 T C 7: 27,673,993 E11G unknown Het
Micu1 G T 10: 59,863,202 E434* probably null Het
Myh13 A G 11: 67,364,922 E1679G probably benign Het
Myh15 A G 16: 49,069,514 N156S probably benign Het
Nab1 A G 1: 52,490,582 I52T probably damaging Het
Naip1 T C 13: 100,423,106 H1130R possibly damaging Het
Olfr1056 A G 2: 86,356,265 V39A probably benign Het
Olfr118 T G 17: 37,672,696 Y224* probably null Het
P2rx2 A G 5: 110,341,661 Y136H probably damaging Het
Prss40 A G 1: 34,559,905 V59A possibly damaging Het
Riox1 A T 12: 83,950,644 probably null Het
Rxrb T G 17: 34,037,438 C384W probably damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Tmprss5 T A 9: 49,115,135 L373* probably null Het
Trpm2 A C 10: 77,947,880 I253S possibly damaging Het
Ush2a C T 1: 188,947,040 T4815I probably damaging Het
Vmn2r73 A T 7: 85,857,767 M779K probably damaging Het
Other mutations in Mlph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mlph APN 1 90939390 missense probably damaging 1.00
IGL01779:Mlph APN 1 90942950 missense probably benign
IGL01952:Mlph APN 1 90933471 missense probably benign 0.00
beau UTSW 1 90928122 missense probably damaging 1.00
Golem UTSW 1 unclassified
koala UTSW 1 90933301 unclassified probably benign
R0652:Mlph UTSW 1 90942908 missense possibly damaging 0.89
R1374:Mlph UTSW 1 90941703 missense probably damaging 1.00
R1643:Mlph UTSW 1 90941734 missense probably damaging 1.00
R1853:Mlph UTSW 1 90945667 nonsense probably null
R3875:Mlph UTSW 1 90928122 missense probably damaging 1.00
R4632:Mlph UTSW 1 90939386 missense probably damaging 0.99
R4720:Mlph UTSW 1 90941697 missense probably damaging 1.00
R4963:Mlph UTSW 1 90939390 missense probably damaging 1.00
R5588:Mlph UTSW 1 90931599 missense possibly damaging 0.91
R5901:Mlph UTSW 1 90939814 missense probably damaging 1.00
R6063:Mlph UTSW 1 90928160 missense probably damaging 1.00
R6912:Mlph UTSW 1 90945620 missense probably damaging 0.98
R7019:Mlph UTSW 1 90941706 missense probably damaging 1.00
R7336:Mlph UTSW 1 90921983 splice site probably null
R7491:Mlph UTSW 1 90939378 missense possibly damaging 0.87
R7507:Mlph UTSW 1 90927707 start gained probably benign
R7648:Mlph UTSW 1 90933526 splice site probably null
R7899:Mlph UTSW 1 90941763 nonsense probably null
R7982:Mlph UTSW 1 90941763 nonsense probably null
X0013:Mlph UTSW 1 90928154 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGTGTGCTCAGTCCCTCTCAG -3'
(R):5'- TCCAGGTATCACAGGGAAGC -3'

Sequencing Primer
(F):5'- TCTCAGGTGAGCCCTACTCTGAG -3'
(R):5'- TATCACAGGGAAGCACTGAGC -3'
Posted On2014-11-11