Incidental Mutation 'R2395:Olfr1056'
ID248481
Institutional Source Beutler Lab
Gene Symbol Olfr1056
Ensembl Gene ENSMUSG00000075188
Gene Nameolfactory receptor 1056
SynonymsMOR186-2, GA_x6K02T2Q125-47827833-47826892
MMRRC Submission 040363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2395 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86354398-86362469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86356265 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 39 (V39A)
Ref Sequence ENSEMBL: ENSMUSP00000149545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099893] [ENSMUST00000216547]
Predicted Effect probably benign
Transcript: ENSMUST00000099893
AA Change: V39A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000097478
Gene: ENSMUSG00000075188
AA Change: V39A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.6e-47 PFAM
Pfam:7tm_1 41 290 7.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216547
AA Change: V39A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.1059 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,962 E622G probably benign Het
Abca8a A G 11: 110,068,788 Y707H probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Acsl3 T C 1: 78,705,368 V661A probably benign Het
B3glct A G 5: 149,754,186 T427A probably damaging Het
Cblc C A 7: 19,785,380 C341F probably damaging Het
Cntn2 T C 1: 132,526,372 S299G probably benign Het
Dcp1b T C 6: 119,215,064 S314P probably benign Het
Dnah6 T C 6: 73,091,967 probably null Het
Fam214b C A 4: 43,035,964 E256* probably null Het
Fmn1 A G 2: 113,365,181 T409A unknown Het
Hltf C T 3: 20,092,742 A555V probably benign Het
Kmt2c T C 5: 25,315,152 I1987V probably benign Het
Map3k10 T C 7: 27,673,993 E11G unknown Het
Micu1 G T 10: 59,863,202 E434* probably null Het
Mlph A G 1: 90,933,506 T288A probably benign Het
Myh13 A G 11: 67,364,922 E1679G probably benign Het
Myh15 A G 16: 49,069,514 N156S probably benign Het
Nab1 A G 1: 52,490,582 I52T probably damaging Het
Naip1 T C 13: 100,423,106 H1130R possibly damaging Het
Olfr118 T G 17: 37,672,696 Y224* probably null Het
P2rx2 A G 5: 110,341,661 Y136H probably damaging Het
Prss40 A G 1: 34,559,905 V59A possibly damaging Het
Riox1 A T 12: 83,950,644 probably null Het
Rxrb T G 17: 34,037,438 C384W probably damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Tmprss5 T A 9: 49,115,135 L373* probably null Het
Trpm2 A C 10: 77,947,880 I253S possibly damaging Het
Ush2a C T 1: 188,947,040 T4815I probably damaging Het
Vmn2r73 A T 7: 85,857,767 M779K probably damaging Het
Other mutations in Olfr1056
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Olfr1056 APN 2 86356133 missense possibly damaging 0.89
R0525:Olfr1056 UTSW 2 86356275 missense probably benign 0.00
R0544:Olfr1056 UTSW 2 86355663 missense probably damaging 1.00
R1124:Olfr1056 UTSW 2 86355895 missense probably damaging 1.00
R2011:Olfr1056 UTSW 2 86356186 missense possibly damaging 0.70
R2508:Olfr1056 UTSW 2 86356364 missense possibly damaging 0.89
R3609:Olfr1056 UTSW 2 86355482 missense probably damaging 0.96
R3923:Olfr1056 UTSW 2 86355861 missense probably benign 0.22
R4531:Olfr1056 UTSW 2 86355974 missense probably damaging 1.00
R4836:Olfr1056 UTSW 2 86355750 missense probably benign 0.39
R5085:Olfr1056 UTSW 2 86355974 missense probably damaging 1.00
R6210:Olfr1056 UTSW 2 86356358 missense probably benign 0.00
R7265:Olfr1056 UTSW 2 86355744 missense probably benign 0.00
R8059:Olfr1056 UTSW 2 86355962 missense probably benign 0.01
X0020:Olfr1056 UTSW 2 86355774 missense probably benign 0.09
Z1088:Olfr1056 UTSW 2 86355893 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACATAGCGGTCATAAGCCATAGC -3'
(R):5'- CCTGAACCCAGTGTGCTTTG -3'

Sequencing Primer
(F):5'- GCTGGAATGCACACCAATTATAG -3'
(R):5'- AACCCAGTGTGCTTTGAAGATTGC -3'
Posted On2014-11-11