Incidental Mutation 'R2395:P2rx2'
ID248487
Institutional Source Beutler Lab
Gene Symbol P2rx2
Ensembl Gene ENSMUSG00000029503
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 2
SynonymsP2x2, P2X2a
MMRRC Submission 040363-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2395 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110339812-110343212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110341661 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 136 (Y136H)
Ref Sequence ENSEMBL: ENSMUSP00000142567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000058016] [ENSMUST00000112478] [ENSMUST00000112481] [ENSMUST00000185691] [ENSMUST00000186408] [ENSMUST00000195985] [ENSMUST00000200037] [ENSMUST00000200214]
Predicted Effect probably benign
Transcript: ENSMUST00000007296
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058016
AA Change: Y235H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054233
Gene: ENSMUSG00000029503
AA Change: Y235H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 388 1.5e-149 PFAM
low complexity region 419 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112478
AA Change: Y223H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108097
Gene: ENSMUSG00000029503
AA Change: Y223H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 395 4e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112481
SMART Domains Protein: ENSMUSP00000108100
Gene: ENSMUSG00000007080

DomainStartEndE-ValueType
Pfam:DUF1744 13 48 2.7e-13 PFAM
coiled coil region 60 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152495
Predicted Effect probably benign
Transcript: ENSMUST00000185691
SMART Domains Protein: ENSMUSP00000139397
Gene: ENSMUSG00000072754

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Colipase-like 26 85 3.8e-19 PFAM
Pfam:Colipase-like 66 155 3.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190060
Predicted Effect probably damaging
Transcript: ENSMUST00000195985
AA Change: Y223H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143047
Gene: ENSMUSG00000029503
AA Change: Y223H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 393 7.4e-144 PFAM
low complexity region 419 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199165
Predicted Effect probably damaging
Transcript: ENSMUST00000200037
AA Change: Y223H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143554
Gene: ENSMUSG00000029503
AA Change: Y223H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 388 5.5e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200214
AA Change: Y136H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142567
Gene: ENSMUSG00000029503
AA Change: Y136H

DomainStartEndE-ValueType
Pfam:P2X_receptor 1 306 1.3e-117 PFAM
low complexity region 332 349 N/A INTRINSIC
Meta Mutation Damage Score 0.5276 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are viable and show no gross pathology. Mice show abnormal ventilatory and electrophysiological responses to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,962 E622G probably benign Het
Abca8a A G 11: 110,068,788 Y707H probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Acsl3 T C 1: 78,705,368 V661A probably benign Het
B3glct A G 5: 149,754,186 T427A probably damaging Het
Cblc C A 7: 19,785,380 C341F probably damaging Het
Cntn2 T C 1: 132,526,372 S299G probably benign Het
Dcp1b T C 6: 119,215,064 S314P probably benign Het
Dnah6 T C 6: 73,091,967 probably null Het
Fam214b C A 4: 43,035,964 E256* probably null Het
Fmn1 A G 2: 113,365,181 T409A unknown Het
Hltf C T 3: 20,092,742 A555V probably benign Het
Kmt2c T C 5: 25,315,152 I1987V probably benign Het
Map3k10 T C 7: 27,673,993 E11G unknown Het
Micu1 G T 10: 59,863,202 E434* probably null Het
Mlph A G 1: 90,933,506 T288A probably benign Het
Myh13 A G 11: 67,364,922 E1679G probably benign Het
Myh15 A G 16: 49,069,514 N156S probably benign Het
Nab1 A G 1: 52,490,582 I52T probably damaging Het
Naip1 T C 13: 100,423,106 H1130R possibly damaging Het
Olfr1056 A G 2: 86,356,265 V39A probably benign Het
Olfr118 T G 17: 37,672,696 Y224* probably null Het
Prss40 A G 1: 34,559,905 V59A possibly damaging Het
Riox1 A T 12: 83,950,644 probably null Het
Rxrb T G 17: 34,037,438 C384W probably damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Tmprss5 T A 9: 49,115,135 L373* probably null Het
Trpm2 A C 10: 77,947,880 I253S possibly damaging Het
Ush2a C T 1: 188,947,040 T4815I probably damaging Het
Vmn2r73 A T 7: 85,857,767 M779K probably damaging Het
Other mutations in P2rx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:P2rx2 APN 5 110341805 missense probably benign 0.22
IGL02523:P2rx2 APN 5 110342042 missense probably damaging 0.98
IGL02535:P2rx2 APN 5 110342353 missense probably benign 0.02
IGL02663:P2rx2 APN 5 110340249 missense possibly damaging 0.84
IGL02663:P2rx2 APN 5 110340186 unclassified probably null
IGL02756:P2rx2 APN 5 110342410 splice site probably benign
IGL03177:P2rx2 APN 5 110341613 missense probably damaging 1.00
R0382:P2rx2 UTSW 5 110341179 missense probably benign 0.25
R2092:P2rx2 UTSW 5 110341141 missense probably damaging 1.00
R2104:P2rx2 UTSW 5 110341141 missense probably damaging 1.00
R2226:P2rx2 UTSW 5 110342879 missense probably damaging 0.98
R4854:P2rx2 UTSW 5 110340927 missense probably damaging 0.99
R4863:P2rx2 UTSW 5 110341568 missense probably benign 0.23
R5125:P2rx2 UTSW 5 110342651 missense possibly damaging 0.59
R5250:P2rx2 UTSW 5 110341588 missense probably damaging 0.98
R5366:P2rx2 UTSW 5 110341828 missense probably damaging 1.00
R5559:P2rx2 UTSW 5 110340561 missense possibly damaging 0.90
R5827:P2rx2 UTSW 5 110340329 missense probably benign 0.03
R7617:P2rx2 UTSW 5 110342084 missense probably damaging 1.00
R7792:P2rx2 UTSW 5 110340344 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGATGCAGTAAAACCCTTCCTAGG -3'
(R):5'- CCACTGTCTGTAACTTTGCAGC -3'

Sequencing Primer
(F):5'- CCCTTCCTAGGCAGCAAATG -3'
(R):5'- TTCTGGGTAAAATGGCCCC -3'
Posted On2014-11-11