Incidental Mutation 'R2395:Dcp1b'
ID248489
Institutional Source Beutler Lab
Gene Symbol Dcp1b
Ensembl Gene ENSMUSG00000041477
Gene Namedecapping mRNA 1B
SynonymsB930050E02Rik
MMRRC Submission 040363-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.468) question?
Stock #R2395 (G1)
Quality Score168
Status Validated
Chromosome6
Chromosomal Location119175253-119221616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119215064 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 314 (S314P)
Ref Sequence ENSEMBL: ENSMUSP00000108397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073909] [ENSMUST00000112777]
Predicted Effect probably benign
Transcript: ENSMUST00000073909
AA Change: S314P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073568
Gene: ENSMUSG00000041477
AA Change: S314P

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:DCP1 10 131 1.3e-53 PFAM
low complexity region 250 260 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112777
AA Change: S314P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108397
Gene: ENSMUSG00000041477
AA Change: S314P

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:DCP1 13 129 3e-46 PFAM
low complexity region 250 260 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:mRNA_decap_C 536 578 2.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149651
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that function in removing the 5' cap from mRNAs, which is a step in regulated mRNA decay. This protein localizes to cytoplasmic foci which are the site of mRNA breakdown and turnover. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,962 E622G probably benign Het
Abca8a A G 11: 110,068,788 Y707H probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Acsl3 T C 1: 78,705,368 V661A probably benign Het
B3glct A G 5: 149,754,186 T427A probably damaging Het
Cblc C A 7: 19,785,380 C341F probably damaging Het
Cntn2 T C 1: 132,526,372 S299G probably benign Het
Dnah6 T C 6: 73,091,967 probably null Het
Fam214b C A 4: 43,035,964 E256* probably null Het
Fmn1 A G 2: 113,365,181 T409A unknown Het
Hltf C T 3: 20,092,742 A555V probably benign Het
Kmt2c T C 5: 25,315,152 I1987V probably benign Het
Map3k10 T C 7: 27,673,993 E11G unknown Het
Micu1 G T 10: 59,863,202 E434* probably null Het
Mlph A G 1: 90,933,506 T288A probably benign Het
Myh13 A G 11: 67,364,922 E1679G probably benign Het
Myh15 A G 16: 49,069,514 N156S probably benign Het
Nab1 A G 1: 52,490,582 I52T probably damaging Het
Naip1 T C 13: 100,423,106 H1130R possibly damaging Het
Olfr1056 A G 2: 86,356,265 V39A probably benign Het
Olfr118 T G 17: 37,672,696 Y224* probably null Het
P2rx2 A G 5: 110,341,661 Y136H probably damaging Het
Prss40 A G 1: 34,559,905 V59A possibly damaging Het
Riox1 A T 12: 83,950,644 probably null Het
Rxrb T G 17: 34,037,438 C384W probably damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Tmprss5 T A 9: 49,115,135 L373* probably null Het
Trpm2 A C 10: 77,947,880 I253S possibly damaging Het
Ush2a C T 1: 188,947,040 T4815I probably damaging Het
Vmn2r73 A T 7: 85,857,767 M779K probably damaging Het
Other mutations in Dcp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Dcp1b APN 6 119215358 missense probably damaging 0.96
IGL01320:Dcp1b APN 6 119215075 missense probably benign 0.29
IGL01348:Dcp1b APN 6 119183718 missense probably damaging 1.00
IGL01635:Dcp1b APN 6 119206537 missense probably damaging 1.00
IGL02888:Dcp1b APN 6 119220087 utr 3 prime probably benign
IGL03280:Dcp1b APN 6 119180058 intron probably benign
R1672:Dcp1b UTSW 6 119217911 missense probably benign
R2421:Dcp1b UTSW 6 119215266 missense probably benign 0.28
R2512:Dcp1b UTSW 6 119206512 missense possibly damaging 0.69
R2870:Dcp1b UTSW 6 119214774 missense probably benign
R2870:Dcp1b UTSW 6 119214774 missense probably benign
R4450:Dcp1b UTSW 6 119206476 missense probably benign 0.01
R5394:Dcp1b UTSW 6 119175367 missense probably damaging 1.00
R5688:Dcp1b UTSW 6 119217911 missense probably benign
R7734:Dcp1b UTSW 6 119215283 missense probably benign 0.00
R7752:Dcp1b UTSW 6 119175357 missense possibly damaging 0.64
R7847:Dcp1b UTSW 6 119215295 missense probably benign
R8274:Dcp1b UTSW 6 119183651 missense probably damaging 1.00
R8325:Dcp1b UTSW 6 119215436 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAAACTGTAAAGCCCTCC -3'
(R):5'- GCACAGGGGTTATACTTATGCAC -3'

Sequencing Primer
(F):5'- AAAGCCCTCCCGGACCTTTG -3'
(R):5'- AGGGGTTATACTTATGCACTGCCC -3'
Posted On2014-11-11