Incidental Mutation 'R2395:Tmprss5'
ID248495
Institutional Source Beutler Lab
Gene Symbol Tmprss5
Ensembl Gene ENSMUSG00000032268
Gene Nametransmembrane protease, serine 5 (spinesin)
Synonymsspinesin
MMRRC Submission 040363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2395 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location49081260-49117587 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 49115135 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 373 (L373*)
Ref Sequence ENSEMBL: ENSMUSP00000129482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070390] [ENSMUST00000165088] [ENSMUST00000166272] [ENSMUST00000167095] [ENSMUST00000170246]
Predicted Effect probably null
Transcript: ENSMUST00000070390
AA Change: L379*
SMART Domains Protein: ENSMUSP00000064527
Gene: ENSMUSG00000032268
AA Change: L379*

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Pfam:SRCR_2 106 203 4.2e-38 PFAM
Tryp_SPc 207 438 1.28e-90 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165088
AA Change: L389*
SMART Domains Protein: ENSMUSP00000132181
Gene: ENSMUSG00000032268
AA Change: L389*

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:SRCR_2 116 213 2.9e-38 PFAM
Tryp_SPc 217 448 1.28e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166272
SMART Domains Protein: ENSMUSP00000130069
Gene: ENSMUSG00000032268

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167095
AA Change: L315*
SMART Domains Protein: ENSMUSP00000131650
Gene: ENSMUSG00000032268
AA Change: L315*

DomainStartEndE-ValueType
Pfam:SRCR_2 42 139 1.1e-38 PFAM
Tryp_SPc 143 374 1.28e-90 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170246
AA Change: L373*
SMART Domains Protein: ENSMUSP00000129482
Gene: ENSMUSG00000032268
AA Change: L373*

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Pfam:SRCR_2 100 197 1.4e-38 PFAM
Tryp_SPc 201 432 1.28e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170426
SMART Domains Protein: ENSMUSP00000128662
Gene: ENSMUSG00000032268

DomainStartEndE-ValueType
Pfam:SRCR_2 7 84 3.4e-28 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. Serine proteases are known to be involved in many physiological and pathological processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,962 E622G probably benign Het
Abca8a A G 11: 110,068,788 Y707H probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Acsl3 T C 1: 78,705,368 V661A probably benign Het
B3glct A G 5: 149,754,186 T427A probably damaging Het
Cblc C A 7: 19,785,380 C341F probably damaging Het
Cntn2 T C 1: 132,526,372 S299G probably benign Het
Dcp1b T C 6: 119,215,064 S314P probably benign Het
Dnah6 T C 6: 73,091,967 probably null Het
Fam214b C A 4: 43,035,964 E256* probably null Het
Fmn1 A G 2: 113,365,181 T409A unknown Het
Hltf C T 3: 20,092,742 A555V probably benign Het
Kmt2c T C 5: 25,315,152 I1987V probably benign Het
Map3k10 T C 7: 27,673,993 E11G unknown Het
Micu1 G T 10: 59,863,202 E434* probably null Het
Mlph A G 1: 90,933,506 T288A probably benign Het
Myh13 A G 11: 67,364,922 E1679G probably benign Het
Myh15 A G 16: 49,069,514 N156S probably benign Het
Nab1 A G 1: 52,490,582 I52T probably damaging Het
Naip1 T C 13: 100,423,106 H1130R possibly damaging Het
Olfr1056 A G 2: 86,356,265 V39A probably benign Het
Olfr118 T G 17: 37,672,696 Y224* probably null Het
P2rx2 A G 5: 110,341,661 Y136H probably damaging Het
Prss40 A G 1: 34,559,905 V59A possibly damaging Het
Riox1 A T 12: 83,950,644 probably null Het
Rxrb T G 17: 34,037,438 C384W probably damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Trpm2 A C 10: 77,947,880 I253S possibly damaging Het
Ush2a C T 1: 188,947,040 T4815I probably damaging Het
Vmn2r73 A T 7: 85,857,767 M779K probably damaging Het
Other mutations in Tmprss5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Tmprss5 APN 9 49109457 makesense probably null
IGL02705:Tmprss5 APN 9 49107147 missense probably benign 0.19
IGL03072:Tmprss5 APN 9 49109018 missense possibly damaging 0.68
IGL03107:Tmprss5 APN 9 49113228 missense possibly damaging 0.78
PIT4366001:Tmprss5 UTSW 9 49112217 missense probably benign 0.24
R0207:Tmprss5 UTSW 9 49113160 missense possibly damaging 0.88
R0477:Tmprss5 UTSW 9 49115165 missense possibly damaging 0.94
R1542:Tmprss5 UTSW 9 49109134 missense possibly damaging 0.81
R1819:Tmprss5 UTSW 9 49107164 missense probably benign 0.09
R4600:Tmprss5 UTSW 9 49113248 missense possibly damaging 0.67
R4967:Tmprss5 UTSW 9 49115517 missense probably damaging 0.98
R5819:Tmprss5 UTSW 9 49114479 splice site probably null
R7266:Tmprss5 UTSW 9 49114541 missense probably benign
R7876:Tmprss5 UTSW 9 49109091 missense probably benign 0.10
R7959:Tmprss5 UTSW 9 49109091 missense probably benign 0.10
Z1177:Tmprss5 UTSW 9 49115155 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGACTCTTGTCCTTTGGC -3'
(R):5'- AAATCCCTGGGTAGTCTGGC -3'

Sequencing Primer
(F):5'- GTCCTGAGGAGCTATGACTCTTC -3'
(R):5'- GGCTTCCCCAGTCCATGTG -3'
Posted On2014-11-11