Incidental Mutation 'R2395:Riox1'
ID248501
Institutional Source Beutler Lab
Gene Symbol Riox1
Ensembl Gene ENSMUSG00000046791
Gene Nameribosomal oxygenase 1
SynonymsNO66, 2410016O06Rik
MMRRC Submission 040363-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R2395 (G1)
Quality Score222
Status Validated
Chromosome12
Chromosomal Location83950608-83952951 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to T at 83950644 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053744] [ENSMUST00000164935]
Predicted Effect probably null
Transcript: ENSMUST00000053744
SMART Domains Protein: ENSMUSP00000057984
Gene: ENSMUSG00000046791

DomainStartEndE-ValueType
low complexity region 15 22 N/A INTRINSIC
low complexity region 44 65 N/A INTRINSIC
JmjC 266 394 5.07e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164935
SMART Domains Protein: ENSMUSP00000129832
Gene: ENSMUSG00000090843

DomainStartEndE-ValueType
low complexity region 153 166 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
low complexity region 533 548 N/A INTRINSIC
internal_repeat_1 577 711 2.78e-6 PROSPERO
Pfam:HEAT_2 776 890 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181399
SMART Domains Protein: ENSMUSP00000137697
Gene: ENSMUSG00000096953

DomainStartEndE-ValueType
low complexity region 1 19 N/A INTRINSIC
low complexity region 27 40 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
low complexity region 68 98 N/A INTRINSIC
low complexity region 117 161 N/A INTRINSIC
low complexity region 171 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223215
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele activated in mesenchyme exhibit increased body length and weight, increased ossification with increased bone mass, bone mineral density, and volume, increased osteoblasts; and decrease osteoclasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,962 E622G probably benign Het
Abca8a A G 11: 110,068,788 Y707H probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Acsl3 T C 1: 78,705,368 V661A probably benign Het
B3glct A G 5: 149,754,186 T427A probably damaging Het
Cblc C A 7: 19,785,380 C341F probably damaging Het
Cntn2 T C 1: 132,526,372 S299G probably benign Het
Dcp1b T C 6: 119,215,064 S314P probably benign Het
Dnah6 T C 6: 73,091,967 probably null Het
Fam214b C A 4: 43,035,964 E256* probably null Het
Fmn1 A G 2: 113,365,181 T409A unknown Het
Hltf C T 3: 20,092,742 A555V probably benign Het
Kmt2c T C 5: 25,315,152 I1987V probably benign Het
Map3k10 T C 7: 27,673,993 E11G unknown Het
Micu1 G T 10: 59,863,202 E434* probably null Het
Mlph A G 1: 90,933,506 T288A probably benign Het
Myh13 A G 11: 67,364,922 E1679G probably benign Het
Myh15 A G 16: 49,069,514 N156S probably benign Het
Nab1 A G 1: 52,490,582 I52T probably damaging Het
Naip1 T C 13: 100,423,106 H1130R possibly damaging Het
Olfr1056 A G 2: 86,356,265 V39A probably benign Het
Olfr118 T G 17: 37,672,696 Y224* probably null Het
P2rx2 A G 5: 110,341,661 Y136H probably damaging Het
Prss40 A G 1: 34,559,905 V59A possibly damaging Het
Rxrb T G 17: 34,037,438 C384W probably damaging Het
Srebf2 C T 15: 82,192,255 T702I probably benign Het
Tmprss5 T A 9: 49,115,135 L373* probably null Het
Trpm2 A C 10: 77,947,880 I253S possibly damaging Het
Ush2a C T 1: 188,947,040 T4815I probably damaging Het
Vmn2r73 A T 7: 85,857,767 M779K probably damaging Het
Other mutations in Riox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Riox1 APN 12 83951794 missense probably damaging 1.00
R1968:Riox1 UTSW 12 83951382 missense probably damaging 1.00
R2158:Riox1 UTSW 12 83950935 missense probably benign 0.00
R5691:Riox1 UTSW 12 83951692 missense possibly damaging 0.54
R6396:Riox1 UTSW 12 83951313 missense possibly damaging 0.88
R6968:Riox1 UTSW 12 83951373 missense probably damaging 0.98
R7322:Riox1 UTSW 12 83950668 unclassified probably benign
R7520:Riox1 UTSW 12 83951771 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTGAAATGCCTCGTGCC -3'
(R):5'- TTCAGCTCCGTCAGTACCTG -3'

Sequencing Primer
(F):5'- GTGCCTTCTTTTCTTACACGGAG -3'
(R):5'- GCCACTTTCGAGTCCGAGTC -3'
Posted On2014-11-11