Mutagenetix > Incidental Mutations

Incidental Mutation 'R2395:Srebf2'

248503

Institutional Source

Beutler Lab

Gene Symbol

Srebf2

Ensembl Gene

ENSMUSG00000022463

Gene Name

sterol regulatory element binding factor 2

Synonyms

nuc, bHLHd2, lop13, SREBP-2, SREBP2gc, SREBP2

MMRRC Submission

040363-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2395 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82147181-82205379 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 82192255 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 702 (T702I)

Ref Sequence

ENSEMBL: ENSMUSP00000155022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023100] [ENSMUST00000229336]

Predicted Effect

probably benign
Transcript: ENSMUST00000023100
AA Change: T742I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000023100
Gene: ENSMUSG00000022463
AA Change: T742I

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
low complexity region	56	75	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
low complexity region	118	137	N/A	INTRINSIC
low complexity region	178	204	N/A	INTRINSIC
low complexity region	210	235	N/A	INTRINSIC
HLH	325	375	3.54e-15	SMART
low complexity region	383	394	N/A	INTRINSIC
low complexity region	397	408	N/A	INTRINSIC
low complexity region	570	586	N/A	INTRINSIC
low complexity region	617	630	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229336
AA Change: T702I

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229390

Predicted Effect

probably benign
Transcript: ENSMUST00000230955

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the a ubiquitously expressed transcription factor that controls cholesterol homeostasis by regulating transcription of sterol-regulated genes. The encoded protein contains a basic helix-loop-helix-leucine zipper (bHLH-Zip) domain and binds the sterol regulatory element 1 motif. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele display prenatal lethality. Mice homozygous for an ENU mutation display cataracts and persistent wounds of the skin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	C	17: 33,065,962	E622G	probably benign	Het
Abca8a	A	G	11: 110,068,788	Y707H	probably damaging	Het
Abcc3	A	G	11: 94,357,306	V1156A	possibly damaging	Het
Acsl3	T	C	1: 78,705,368	V661A	probably benign	Het
B3glct	A	G	5: 149,754,186	T427A	probably damaging	Het
Cblc	C	A	7: 19,785,380	C341F	probably damaging	Het
Cntn2	T	C	1: 132,526,372	S299G	probably benign	Het
Dcp1b	T	C	6: 119,215,064	S314P	probably benign	Het
Dnah6	T	C	6: 73,091,967		probably null	Het
Fam214b	C	A	4: 43,035,964	E256*	probably null	Het
Fmn1	A	G	2: 113,365,181	T409A	unknown	Het
Hltf	C	T	3: 20,092,742	A555V	probably benign	Het
Kmt2c	T	C	5: 25,315,152	I1987V	probably benign	Het
Map3k10	T	C	7: 27,673,993	E11G	unknown	Het
Micu1	G	T	10: 59,863,202	E434*	probably null	Het
Mlph	A	G	1: 90,933,506	T288A	probably benign	Het
Myh13	A	G	11: 67,364,922	E1679G	probably benign	Het
Myh15	A	G	16: 49,069,514	N156S	probably benign	Het
Nab1	A	G	1: 52,490,582	I52T	probably damaging	Het
Naip1	T	C	13: 100,423,106	H1130R	possibly damaging	Het
Olfr1056	A	G	2: 86,356,265	V39A	probably benign	Het
Olfr118	T	G	17: 37,672,696	Y224*	probably null	Het
P2rx2	A	G	5: 110,341,661	Y136H	probably damaging	Het
Prss40	A	G	1: 34,559,905	V59A	possibly damaging	Het
Riox1	A	T	12: 83,950,644		probably null	Het
Rxrb	T	G	17: 34,037,438	C384W	probably damaging	Het
Tmprss5	T	A	9: 49,115,135	L373*	probably null	Het
Trpm2	A	C	10: 77,947,880	I253S	possibly damaging	Het
Ush2a	C	T	1: 188,947,040	T4815I	probably damaging	Het
Vmn2r73	A	T	7: 85,857,767	M779K	probably damaging	Het

Other mutations in Srebf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01311:Srebf2	APN	15	82192203	unclassified	probably benign
IGL01409:Srebf2	APN	15	82171218	missense	probably damaging	1.00
IGL01415:Srebf2	APN	15	82177462	missense	probably benign	0.08
IGL01614:Srebf2	APN	15	82178853	missense	probably benign
IGL01985:Srebf2	APN	15	82192359	missense	probably benign	0.01
IGL02423:Srebf2	APN	15	82175097	missense	probably damaging	1.00
IGL02436:Srebf2	APN	15	82197727	missense	probably benign	0.41
IGL02805:Srebf2	APN	15	82169844	missense	probably benign	0.00
IGL02818:Srebf2	APN	15	82185374	missense	probably damaging	0.99
IGL02823:Srebf2	APN	15	82199774	missense	possibly damaging	0.87
IGL02895:Srebf2	APN	15	82147467	missense	possibly damaging	0.72
IGL03064:Srebf2	APN	15	82192222	missense	probably benign	0.01
IGL03378:Srebf2	APN	15	82169788	missense	probably damaging	1.00
FR4449:Srebf2	UTSW	15	82185335	missense	probably damaging	1.00
FR4548:Srebf2	UTSW	15	82185335	missense	probably damaging	1.00
FR4737:Srebf2	UTSW	15	82185335	missense	probably damaging	1.00
FR4976:Srebf2	UTSW	15	82185335	missense	probably damaging	1.00
R0230:Srebf2	UTSW	15	82182085	missense	probably damaging	1.00
R0702:Srebf2	UTSW	15	82177409	missense	probably damaging	1.00
R0829:Srebf2	UTSW	15	82177589	critical splice donor site	probably null
R1241:Srebf2	UTSW	15	82177519	missense	probably damaging	1.00
R1898:Srebf2	UTSW	15	82203735	missense	probably damaging	1.00
R1957:Srebf2	UTSW	15	82194954	missense	probably benign	0.26
R3771:Srebf2	UTSW	15	82182108	missense	probably benign	0.02
R3772:Srebf2	UTSW	15	82182108	missense	probably benign	0.02
R3773:Srebf2	UTSW	15	82182108	missense	probably benign	0.02
R4030:Srebf2	UTSW	15	82178783	missense	probably damaging	1.00
R4613:Srebf2	UTSW	15	82185348	missense	possibly damaging	0.94
R4670:Srebf2	UTSW	15	82192302	missense	probably damaging	1.00
R4758:Srebf2	UTSW	15	82196169	missense	probably benign	0.01
R4812:Srebf2	UTSW	15	82203825	missense	probably damaging	0.98
R5058:Srebf2	UTSW	15	82182050	missense	probably damaging	0.99
R5063:Srebf2	UTSW	15	82177451	missense	probably benign
R5155:Srebf2	UTSW	15	82196226	missense	probably damaging	1.00
R5166:Srebf2	UTSW	15	82185402	missense	probably damaging	1.00
R5330:Srebf2	UTSW	15	82196208	missense	possibly damaging	0.88
R5398:Srebf2	UTSW	15	82171242	missense	probably damaging	1.00
R5662:Srebf2	UTSW	15	82195003	missense	probably benign	0.01
R5668:Srebf2	UTSW	15	82192255	missense	probably benign	0.26
R5867:Srebf2	UTSW	15	82169786	missense	probably damaging	1.00
R6030:Srebf2	UTSW	15	82177276	splice site	probably null
R6030:Srebf2	UTSW	15	82177276	splice site	probably null
R6928:Srebf2	UTSW	15	82203723	nonsense	probably null
R7269:Srebf2	UTSW	15	82204069	missense	probably benign	0.00
R7464:Srebf2	UTSW	15	82172874	missense	probably damaging	0.97
R7632:Srebf2	UTSW	15	82185296	missense	probably benign
R7831:Srebf2	UTSW	15	82182087	missense	probably damaging	0.98
R7895:Srebf2	UTSW	15	82177240	missense	probably benign	0.02
R7938:Srebf2	UTSW	15	82172815	missense	probably damaging	1.00
R7974:Srebf2	UTSW	15	82178765	missense	probably damaging	1.00
R7991:Srebf2	UTSW	15	82204052	missense	probably damaging	1.00
R8002:Srebf2	UTSW	15	82178765	missense	probably damaging	1.00
R8022:Srebf2	UTSW	15	82178765	missense	probably damaging	1.00
R8137:Srebf2	UTSW	15	82178765	missense	probably damaging	1.00
R8138:Srebf2	UTSW	15	82178765	missense	probably damaging	1.00
R8139:Srebf2	UTSW	15	82178765	missense	probably damaging	1.00
X0064:Srebf2	UTSW	15	82175220	missense	probably damaging	1.00
Z1088:Srebf2	UTSW	15	82194921	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGGGACTTAACTGTCAAGCCTG -3'
(R):5'- CATCTGAGTGTCTAGTCTCCTGTG -3'

Sequencing Primer
(F):5'- ACTGTCAAGCCTGAGAAGTTTC -3'
(R):5'- GTCTAGTCTCCTGTGACGCG -3'

Posted On

2014-11-11