Incidental Mutation 'R2395:Srebf2'
ID248503
Institutional Source Beutler Lab
Gene Symbol Srebf2
Ensembl Gene ENSMUSG00000022463
Gene Namesterol regulatory element binding factor 2
Synonymsnuc, bHLHd2, lop13, SREBP-2, SREBP2gc, SREBP2
MMRRC Submission 040363-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2395 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82147181-82205379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82192255 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 702 (T702I)
Ref Sequence ENSEMBL: ENSMUSP00000155022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023100] [ENSMUST00000229336]
Predicted Effect probably benign
Transcript: ENSMUST00000023100
AA Change: T742I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023100
Gene: ENSMUSG00000022463
AA Change: T742I

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 118 137 N/A INTRINSIC
low complexity region 178 204 N/A INTRINSIC
low complexity region 210 235 N/A INTRINSIC
HLH 325 375 3.54e-15 SMART
low complexity region 383 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229336
AA Change: T702I

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229390
Predicted Effect probably benign
Transcript: ENSMUST00000230955
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the a ubiquitously expressed transcription factor that controls cholesterol homeostasis by regulating transcription of sterol-regulated genes. The encoded protein contains a basic helix-loop-helix-leucine zipper (bHLH-Zip) domain and binds the sterol regulatory element 1 motif. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele display prenatal lethality. Mice homozygous for an ENU mutation display cataracts and persistent wounds of the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,065,962 E622G probably benign Het
Abca8a A G 11: 110,068,788 Y707H probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Acsl3 T C 1: 78,705,368 V661A probably benign Het
B3glct A G 5: 149,754,186 T427A probably damaging Het
Cblc C A 7: 19,785,380 C341F probably damaging Het
Cntn2 T C 1: 132,526,372 S299G probably benign Het
Dcp1b T C 6: 119,215,064 S314P probably benign Het
Dnah6 T C 6: 73,091,967 probably null Het
Fam214b C A 4: 43,035,964 E256* probably null Het
Fmn1 A G 2: 113,365,181 T409A unknown Het
Hltf C T 3: 20,092,742 A555V probably benign Het
Kmt2c T C 5: 25,315,152 I1987V probably benign Het
Map3k10 T C 7: 27,673,993 E11G unknown Het
Micu1 G T 10: 59,863,202 E434* probably null Het
Mlph A G 1: 90,933,506 T288A probably benign Het
Myh13 A G 11: 67,364,922 E1679G probably benign Het
Myh15 A G 16: 49,069,514 N156S probably benign Het
Nab1 A G 1: 52,490,582 I52T probably damaging Het
Naip1 T C 13: 100,423,106 H1130R possibly damaging Het
Olfr1056 A G 2: 86,356,265 V39A probably benign Het
Olfr118 T G 17: 37,672,696 Y224* probably null Het
P2rx2 A G 5: 110,341,661 Y136H probably damaging Het
Prss40 A G 1: 34,559,905 V59A possibly damaging Het
Riox1 A T 12: 83,950,644 probably null Het
Rxrb T G 17: 34,037,438 C384W probably damaging Het
Tmprss5 T A 9: 49,115,135 L373* probably null Het
Trpm2 A C 10: 77,947,880 I253S possibly damaging Het
Ush2a C T 1: 188,947,040 T4815I probably damaging Het
Vmn2r73 A T 7: 85,857,767 M779K probably damaging Het
Other mutations in Srebf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Srebf2 APN 15 82192203 unclassified probably benign
IGL01409:Srebf2 APN 15 82171218 missense probably damaging 1.00
IGL01415:Srebf2 APN 15 82177462 missense probably benign 0.08
IGL01614:Srebf2 APN 15 82178853 missense probably benign
IGL01985:Srebf2 APN 15 82192359 missense probably benign 0.01
IGL02423:Srebf2 APN 15 82175097 missense probably damaging 1.00
IGL02436:Srebf2 APN 15 82197727 missense probably benign 0.41
IGL02805:Srebf2 APN 15 82169844 missense probably benign 0.00
IGL02818:Srebf2 APN 15 82185374 missense probably damaging 0.99
IGL02823:Srebf2 APN 15 82199774 missense possibly damaging 0.87
IGL02895:Srebf2 APN 15 82147467 missense possibly damaging 0.72
IGL03064:Srebf2 APN 15 82192222 missense probably benign 0.01
IGL03378:Srebf2 APN 15 82169788 missense probably damaging 1.00
FR4449:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4548:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4737:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
FR4976:Srebf2 UTSW 15 82185335 missense probably damaging 1.00
R0230:Srebf2 UTSW 15 82182085 missense probably damaging 1.00
R0702:Srebf2 UTSW 15 82177409 missense probably damaging 1.00
R0829:Srebf2 UTSW 15 82177589 critical splice donor site probably null
R1241:Srebf2 UTSW 15 82177519 missense probably damaging 1.00
R1898:Srebf2 UTSW 15 82203735 missense probably damaging 1.00
R1957:Srebf2 UTSW 15 82194954 missense probably benign 0.26
R3771:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R3772:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R3773:Srebf2 UTSW 15 82182108 missense probably benign 0.02
R4030:Srebf2 UTSW 15 82178783 missense probably damaging 1.00
R4613:Srebf2 UTSW 15 82185348 missense possibly damaging 0.94
R4670:Srebf2 UTSW 15 82192302 missense probably damaging 1.00
R4758:Srebf2 UTSW 15 82196169 missense probably benign 0.01
R4812:Srebf2 UTSW 15 82203825 missense probably damaging 0.98
R5058:Srebf2 UTSW 15 82182050 missense probably damaging 0.99
R5063:Srebf2 UTSW 15 82177451 missense probably benign
R5155:Srebf2 UTSW 15 82196226 missense probably damaging 1.00
R5166:Srebf2 UTSW 15 82185402 missense probably damaging 1.00
R5330:Srebf2 UTSW 15 82196208 missense possibly damaging 0.88
R5398:Srebf2 UTSW 15 82171242 missense probably damaging 1.00
R5662:Srebf2 UTSW 15 82195003 missense probably benign 0.01
R5668:Srebf2 UTSW 15 82192255 missense probably benign 0.26
R5867:Srebf2 UTSW 15 82169786 missense probably damaging 1.00
R6030:Srebf2 UTSW 15 82177276 splice site probably null
R6030:Srebf2 UTSW 15 82177276 splice site probably null
R6928:Srebf2 UTSW 15 82203723 nonsense probably null
R7269:Srebf2 UTSW 15 82204069 missense probably benign 0.00
R7464:Srebf2 UTSW 15 82172874 missense probably damaging 0.97
R7632:Srebf2 UTSW 15 82185296 missense probably benign
R7831:Srebf2 UTSW 15 82182087 missense probably damaging 0.98
R7895:Srebf2 UTSW 15 82177240 missense probably benign 0.02
R7914:Srebf2 UTSW 15 82182087 missense probably damaging 0.98
R7978:Srebf2 UTSW 15 82177240 missense probably benign 0.02
R8002:Srebf2 UTSW 15 82178765 missense probably damaging 1.00
R8022:Srebf2 UTSW 15 82178765 missense probably damaging 1.00
X0064:Srebf2 UTSW 15 82175220 missense probably damaging 1.00
Z1088:Srebf2 UTSW 15 82194921 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGGACTTAACTGTCAAGCCTG -3'
(R):5'- CATCTGAGTGTCTAGTCTCCTGTG -3'

Sequencing Primer
(F):5'- ACTGTCAAGCCTGAGAAGTTTC -3'
(R):5'- GTCTAGTCTCCTGTGACGCG -3'
Posted On2014-11-11