Mutagenetix > Incidental Mutations

Incidental Mutation 'R2395:Olfr118'

248507

Institutional Source

Beutler Lab

Gene Symbol

Olfr118

Ensembl Gene

ENSMUSG00000080990

Gene Name

olfactory receptor 118

Synonyms

MOR263-13, GA_x6K02T2PSCP-2131124-2132089

MMRRC Submission

040363-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R2395 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37666988-37673476 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to G at 37672696 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 224 (Y224*)

Ref Sequence

ENSEMBL: ENSMUSP00000151212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]

Predicted Effect

probably null
Transcript: ENSMUST00000122036
AA Change: Y224*

SMART Domains

Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: Y224*

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srv	32	173	2e-6	PFAM
Pfam:7tm_4	37	314	2.1e-57	PFAM
Pfam:7TM_GPCR_Srsx	41	311	5.8e-6	PFAM
Pfam:7tm_1	47	296	1.4e-24	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000215811
AA Change: Y224*

Predicted Effect

probably null
Transcript: ENSMUST00000216551
AA Change: Y224*

Meta Mutation Damage Score

0.9718

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	T	C	17: 33,065,962	E622G	probably benign	Het
Abca8a	A	G	11: 110,068,788	Y707H	probably damaging	Het
Abcc3	A	G	11: 94,357,306	V1156A	possibly damaging	Het
Acsl3	T	C	1: 78,705,368	V661A	probably benign	Het
B3glct	A	G	5: 149,754,186	T427A	probably damaging	Het
Cblc	C	A	7: 19,785,380	C341F	probably damaging	Het
Cntn2	T	C	1: 132,526,372	S299G	probably benign	Het
Dcp1b	T	C	6: 119,215,064	S314P	probably benign	Het
Dnah6	T	C	6: 73,091,967		probably null	Het
Fam214b	C	A	4: 43,035,964	E256*	probably null	Het
Fmn1	A	G	2: 113,365,181	T409A	unknown	Het
Hltf	C	T	3: 20,092,742	A555V	probably benign	Het
Kmt2c	T	C	5: 25,315,152	I1987V	probably benign	Het
Map3k10	T	C	7: 27,673,993	E11G	unknown	Het
Micu1	G	T	10: 59,863,202	E434*	probably null	Het
Mlph	A	G	1: 90,933,506	T288A	probably benign	Het
Myh13	A	G	11: 67,364,922	E1679G	probably benign	Het
Myh15	A	G	16: 49,069,514	N156S	probably benign	Het
Nab1	A	G	1: 52,490,582	I52T	probably damaging	Het
Naip1	T	C	13: 100,423,106	H1130R	possibly damaging	Het
Olfr1056	A	G	2: 86,356,265	V39A	probably benign	Het
P2rx2	A	G	5: 110,341,661	Y136H	probably damaging	Het
Prss40	A	G	1: 34,559,905	V59A	possibly damaging	Het
Riox1	A	T	12: 83,950,644		probably null	Het
Rxrb	T	G	17: 34,037,438	C384W	probably damaging	Het
Srebf2	C	T	15: 82,192,255	T702I	probably benign	Het
Tmprss5	T	A	9: 49,115,135	L373*	probably null	Het
Trpm2	A	C	10: 77,947,880	I253S	possibly damaging	Het
Ush2a	C	T	1: 188,947,040	T4815I	probably damaging	Het
Vmn2r73	A	T	7: 85,857,767	M779K	probably damaging	Het

Other mutations in Olfr118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01300:Olfr118	APN	17	37672887	missense	probably damaging	1.00
IGL02456:Olfr118	APN	17	37672449	missense	possibly damaging	0.90
IGL02750:Olfr118	APN	17	37672609	nonsense	probably null
IGL03083:Olfr118	APN	17	37672660	nonsense	probably null
IGL03339:Olfr118	APN	17	37672557	missense	possibly damaging	0.87
R0032:Olfr118	UTSW	17	37672487	missense	probably damaging	1.00
R1457:Olfr118	UTSW	17	37672925	nonsense	probably null
R1542:Olfr118	UTSW	17	37672251	missense	probably damaging	1.00
R1771:Olfr118	UTSW	17	37672663	missense	probably damaging	1.00
R1893:Olfr118	UTSW	17	37672856	nonsense	probably null
R3619:Olfr118	UTSW	17	37672640	missense	probably benign	0.05
R3917:Olfr118	UTSW	17	37672793	missense	probably damaging	1.00
R3937:Olfr118	UTSW	17	37672967	missense	probably benign	0.01
R5600:Olfr118	UTSW	17	37672285	missense	possibly damaging	0.91
R6415:Olfr118	UTSW	17	37672557	missense	possibly damaging	0.87
R6462:Olfr118	UTSW	17	37672220	missense	probably damaging	1.00
R7355:Olfr118	UTSW	17	37672410	missense	probably benign	0.02
R7861:Olfr118	UTSW	17	37672517	missense	possibly damaging	0.91
R7913:Olfr118	UTSW	17	37672108	missense	probably benign
R7952:Olfr118	UTSW	17	37672817	missense	probably damaging	1.00
R7969:Olfr118	UTSW	17	37672656	missense	probably damaging	1.00
R8879:Olfr118	UTSW	17	37672411	nonsense	probably null
R8923:Olfr118	UTSW	17	37672811	missense	probably benign	0.00
RF003:Olfr118	UTSW	17	37672858	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGAGTCGTGAGGTATGTGCC -3'
(R):5'- GGGCCAAGAGTTTGTCCATTC -3'

Sequencing Primer
(F):5'- CCCATTTGGCATTAGTTTCATGG -3'
(R):5'- CCAAGAGTTTGTCCATTCCTGGTAAG -3'

Posted On

2014-11-11