Incidental Mutation 'R2396:Tmem87a'
ID 248511
Institutional Source Beutler Lab
Gene Symbol Tmem87a
Ensembl Gene ENSMUSG00000033808
Gene Name transmembrane protein 87A
Synonyms A930025J12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock # R2396 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 120355312-120404113 bp(-) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 120404059 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000106357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090042] [ENSMUST00000090046] [ENSMUST00000110729] [ENSMUST00000135074]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000043755
Predicted Effect probably null
Transcript: ENSMUST00000090042
AA Change: M1K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000087496
Gene: ENSMUSG00000033808
AA Change: M1K

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 471 1.1e-87 PFAM
low complexity region 480 486 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090046
AA Change: M1K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000087500
Gene: ENSMUSG00000033808
AA Change: M1K

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 185 472 1.5e-85 PFAM
low complexity region 481 487 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110729
AA Change: M1K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000106357
Gene: ENSMUSG00000033808
AA Change: M1K

DomainStartEndE-ValueType
Pfam:Lung_7-TM_R 184 472 2.4e-86 PFAM
low complexity region 481 487 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131523
Predicted Effect probably benign
Transcript: ENSMUST00000135074
SMART Domains Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
Pfam:Gal_mutarotas_2 221 292 2.3e-21 PFAM
Pfam:Glyco_hydro_31 333 778 2.5e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154574
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,435,395 L519P possibly damaging Het
Adamtsl1 G A 4: 86,343,119 W1189* probably null Het
Col4a4 C G 1: 82,507,072 M491I unknown Het
Col5a1 C A 2: 27,986,729 D813E unknown Het
Cyp4b1 T C 4: 115,641,646 Y113C probably benign Het
Dmac1 A G 4: 75,278,221 F11L unknown Het
Dnah9 G T 11: 66,085,158 T1355K probably benign Het
Efemp1 G A 11: 28,867,941 R140Q possibly damaging Het
Fndc3a T C 14: 72,683,683 D17G possibly damaging Het
Grm8 C T 6: 27,761,242 A328T probably damaging Het
Lepr C A 4: 101,733,528 A101E probably benign Het
Ncapg A G 5: 45,678,373 N382S probably benign Het
Olfr1026 T C 2: 85,923,925 I219T probably benign Het
Olfr1349 C A 7: 6,514,785 V215F probably damaging Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pigb T A 9: 73,015,271 R11* probably null Het
Prl8a1 C A 13: 27,574,024 R234L probably benign Het
Spred3 T C 7: 29,166,634 H80R probably damaging Het
Sptlc3 T C 2: 139,566,586 I207T probably benign Het
Tll1 C A 8: 64,070,290 G463* probably null Het
Tm4sf4 T G 3: 57,437,760 C196G unknown Het
Tmem92 A G 11: 94,782,407 L10P probably damaging Het
Trdn A T 10: 33,195,982 E215V probably damaging Het
Trpm2 A T 10: 77,930,637 D849E probably benign Het
Other mutations in Tmem87a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tmem87a APN 2 120379780 splice site probably benign
IGL00912:Tmem87a APN 2 120403936 missense possibly damaging 0.54
IGL01301:Tmem87a APN 2 120380769 missense probably benign 0.01
IGL01413:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL01418:Tmem87a APN 2 120385870 missense probably benign 0.06
IGL02083:Tmem87a APN 2 120397380 missense probably damaging 1.00
IGL02150:Tmem87a APN 2 120360076 missense probably damaging 0.99
IGL02256:Tmem87a APN 2 120377896 missense probably damaging 1.00
IGL02314:Tmem87a APN 2 120404021 missense possibly damaging 0.57
IGL02501:Tmem87a APN 2 120404053 missense probably damaging 0.98
IGL02550:Tmem87a APN 2 120374485 splice site probably null
IGL03082:Tmem87a APN 2 120397366 missense possibly damaging 0.81
ANU18:Tmem87a UTSW 2 120380769 missense probably benign 0.01
R0254:Tmem87a UTSW 2 120375507 missense probably damaging 1.00
R0285:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R0498:Tmem87a UTSW 2 120394465 missense probably benign 0.01
R0611:Tmem87a UTSW 2 120375448 missense possibly damaging 0.46
R0632:Tmem87a UTSW 2 120359542 missense probably damaging 1.00
R0787:Tmem87a UTSW 2 120370484 missense probably benign 0.22
R1599:Tmem87a UTSW 2 120394387 missense probably damaging 1.00
R1977:Tmem87a UTSW 2 120374504 missense probably benign 0.02
R2059:Tmem87a UTSW 2 120369292 missense probably damaging 1.00
R2496:Tmem87a UTSW 2 120394378 missense probably damaging 0.96
R4478:Tmem87a UTSW 2 120369343 nonsense probably null
R4621:Tmem87a UTSW 2 120397424 missense probably benign 0.00
R4739:Tmem87a UTSW 2 120360037 critical splice donor site probably null
R5138:Tmem87a UTSW 2 120371545 missense possibly damaging 0.88
R5314:Tmem87a UTSW 2 120377926 missense probably damaging 0.99
R5391:Tmem87a UTSW 2 120362877 critical splice donor site probably null
R5536:Tmem87a UTSW 2 120397430 missense probably damaging 0.96
R5618:Tmem87a UTSW 2 120369306 missense probably benign 0.44
R5642:Tmem87a UTSW 2 120403946 missense probably benign 0.00
R5884:Tmem87a UTSW 2 120404124 unclassified probably benign
R6104:Tmem87a UTSW 2 120394424 missense probably benign 0.01
R6158:Tmem87a UTSW 2 120360103 splice site probably null
R6195:Tmem87a UTSW 2 120392175 splice site probably null
R6233:Tmem87a UTSW 2 120392175 splice site probably null
R6261:Tmem87a UTSW 2 120404021 missense possibly damaging 0.57
R6403:Tmem87a UTSW 2 120380771 missense possibly damaging 0.94
R6405:Tmem87a UTSW 2 120379750 missense probably damaging 1.00
R6540:Tmem87a UTSW 2 120403919 missense probably benign 0.00
R6583:Tmem87a UTSW 2 120375477 missense possibly damaging 0.93
R6995:Tmem87a UTSW 2 120362928 missense possibly damaging 0.91
R7081:Tmem87a UTSW 2 120380783 missense possibly damaging 0.88
R7384:Tmem87a UTSW 2 120371523 critical splice donor site probably null
R7558:Tmem87a UTSW 2 120374510 missense probably benign 0.00
R7904:Tmem87a UTSW 2 120379717 missense probably damaging 1.00
R8124:Tmem87a UTSW 2 120392195 missense probably benign
R8165:Tmem87a UTSW 2 120370478 missense possibly damaging 0.95
R8259:Tmem87a UTSW 2 120397447 missense possibly damaging 0.65
R8315:Tmem87a UTSW 2 120403960 missense probably damaging 0.99
R8971:Tmem87a UTSW 2 120360060 missense
R9124:Tmem87a UTSW 2 120394360 critical splice donor site probably null
R9157:Tmem87a UTSW 2 120379612 missense possibly damaging 0.66
R9188:Tmem87a UTSW 2 120402763 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATCTTCCTGGACCCCTTGG -3'
(R):5'- CAGTAGACTCAAAGTTTCTGGGG -3'

Sequencing Primer
(F):5'- ACCCCCTTCAGGCTCAGTAG -3'
(R):5'- CTCAAAGTTTCTGGGGCGCTC -3'
Posted On 2014-11-11