Incidental Mutation 'R2396:Sptlc3'
ID 248512
Institutional Source Beutler Lab
Gene Symbol Sptlc3
Ensembl Gene ENSMUSG00000039092
Gene Name serine palmitoyltransferase, long chain base subunit 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R2396 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 139493913-139637674 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139566586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 207 (I207T)
Ref Sequence ENSEMBL: ENSMUSP00000105710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]
AlphaFold Q8BG54
Predicted Effect probably benign
Transcript: ENSMUST00000047370
AA Change: I207T

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: I207T

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110083
AA Change: I207T

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: I207T

DomainStartEndE-ValueType
transmembrane domain 60 79 N/A INTRINSIC
Pfam:Aminotran_1_2 160 520 4.8e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134801
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,435,395 L519P possibly damaging Het
Adamtsl1 G A 4: 86,343,119 W1189* probably null Het
Col4a4 C G 1: 82,507,072 M491I unknown Het
Col5a1 C A 2: 27,986,729 D813E unknown Het
Cyp4b1 T C 4: 115,641,646 Y113C probably benign Het
Dmac1 A G 4: 75,278,221 F11L unknown Het
Dnah9 G T 11: 66,085,158 T1355K probably benign Het
Efemp1 G A 11: 28,867,941 R140Q possibly damaging Het
Fndc3a T C 14: 72,683,683 D17G possibly damaging Het
Grm8 C T 6: 27,761,242 A328T probably damaging Het
Lepr C A 4: 101,733,528 A101E probably benign Het
Ncapg A G 5: 45,678,373 N382S probably benign Het
Olfr1026 T C 2: 85,923,925 I219T probably benign Het
Olfr1349 C A 7: 6,514,785 V215F probably damaging Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pigb T A 9: 73,015,271 R11* probably null Het
Prl8a1 C A 13: 27,574,024 R234L probably benign Het
Spred3 T C 7: 29,166,634 H80R probably damaging Het
Tll1 C A 8: 64,070,290 G463* probably null Het
Tm4sf4 T G 3: 57,437,760 C196G unknown Het
Tmem87a A T 2: 120,404,059 M1K probably null Het
Tmem92 A G 11: 94,782,407 L10P probably damaging Het
Trdn A T 10: 33,195,982 E215V probably damaging Het
Trpm2 A T 10: 77,930,637 D849E probably benign Het
Other mutations in Sptlc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Sptlc3 APN 2 139546421 missense possibly damaging 0.55
IGL01537:Sptlc3 APN 2 139589695 missense possibly damaging 0.95
IGL01996:Sptlc3 APN 2 139581504 splice site probably benign
IGL02512:Sptlc3 APN 2 139547203 missense probably damaging 1.00
IGL03278:Sptlc3 APN 2 139589659 missense probably damaging 1.00
IGL03286:Sptlc3 APN 2 139589659 missense probably damaging 1.00
R0266:Sptlc3 UTSW 2 139596037 missense possibly damaging 0.93
R0362:Sptlc3 UTSW 2 139546555 splice site probably benign
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1464:Sptlc3 UTSW 2 139547234 missense probably benign 0.00
R1494:Sptlc3 UTSW 2 139589560 missense possibly damaging 0.58
R1847:Sptlc3 UTSW 2 139625923 missense probably benign 0.08
R1919:Sptlc3 UTSW 2 139566675 missense possibly damaging 0.66
R2093:Sptlc3 UTSW 2 139625874 missense possibly damaging 0.89
R2972:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R2973:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R2974:Sptlc3 UTSW 2 139589661 missense probably damaging 1.00
R4601:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4602:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4610:Sptlc3 UTSW 2 139636680 missense probably benign 0.01
R4745:Sptlc3 UTSW 2 139547167 missense probably damaging 1.00
R4779:Sptlc3 UTSW 2 139589589 missense probably benign 0.04
R4992:Sptlc3 UTSW 2 139596003 missense probably benign 0.04
R5162:Sptlc3 UTSW 2 139631343 missense probably benign 0.11
R5401:Sptlc3 UTSW 2 139636723 missense possibly damaging 0.75
R5406:Sptlc3 UTSW 2 139546478 missense probably benign 0.26
R5642:Sptlc3 UTSW 2 139546408 missense probably damaging 0.96
R5840:Sptlc3 UTSW 2 139547206 missense probably damaging 1.00
R6057:Sptlc3 UTSW 2 139581613 missense probably damaging 0.99
R6376:Sptlc3 UTSW 2 139636772 missense probably benign 0.21
R6852:Sptlc3 UTSW 2 139566586 missense probably benign 0.44
R7026:Sptlc3 UTSW 2 139537688 missense probably benign
R7412:Sptlc3 UTSW 2 139589617 missense possibly damaging 0.75
R7516:Sptlc3 UTSW 2 139589518 missense probably benign 0.11
R7733:Sptlc3 UTSW 2 139631368 missense possibly damaging 0.77
R7826:Sptlc3 UTSW 2 139547195 missense probably benign 0.44
R7949:Sptlc3 UTSW 2 139625875 missense possibly damaging 0.81
R9224:Sptlc3 UTSW 2 139494234 missense probably benign 0.17
R9237:Sptlc3 UTSW 2 139566685 missense probably benign 0.40
R9319:Sptlc3 UTSW 2 139636810 missense possibly damaging 0.65
R9330:Sptlc3 UTSW 2 139546503 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGGCTACATTCAACTGTGTTTCC -3'
(R):5'- TGCCAACGCTTTTGATAAAGG -3'

Sequencing Primer
(F):5'- ggtctgtgttggtgtatg -3'
(R):5'- CTTGGGAGTGGTATAGCAG -3'
Posted On 2014-11-11