Incidental Mutation 'R2396:Lepr'
ID 248517
Institutional Source Beutler Lab
Gene Symbol Lepr
Ensembl Gene ENSMUSG00000057722
Gene Name leptin receptor
Synonyms leptin receptor gene-related protein, obl, Obr, Leprb, obese-like, Modb1, LEPROT, OB-RGRP
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2396 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 101574601-101672549 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 101590725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 101 (A101E)
Ref Sequence ENSEMBL: ENSMUSP00000102534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921] [ENSMUST00000145024]
AlphaFold P48356
Predicted Effect probably benign
Transcript: ENSMUST00000037552
AA Change: A101E

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: A101E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102777
AA Change: A101E

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: A101E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106921
AA Change: A101E

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: A101E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145024
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,261,356 (GRCm39) W1189* probably null Het
Col4a4 C G 1: 82,484,793 (GRCm39) M491I unknown Het
Col5a1 C A 2: 27,876,741 (GRCm39) D813E unknown Het
Cyp4b1 T C 4: 115,498,843 (GRCm39) Y113C probably benign Het
Dmac1 A G 4: 75,196,458 (GRCm39) F11L unknown Het
Dnah9 G T 11: 65,975,984 (GRCm39) T1355K probably benign Het
Efemp1 G A 11: 28,817,941 (GRCm39) R140Q possibly damaging Het
Elapor2 T C 5: 9,485,395 (GRCm39) L519P possibly damaging Het
Fndc3a T C 14: 72,921,123 (GRCm39) D17G possibly damaging Het
Grm8 C T 6: 27,761,241 (GRCm39) A328T probably damaging Het
Ncapg A G 5: 45,835,715 (GRCm39) N382S probably benign Het
Or10am5 C A 7: 6,517,784 (GRCm39) V215F probably damaging Het
Or5m13b T C 2: 85,754,269 (GRCm39) I219T probably benign Het
Pacs2 G A 12: 113,026,987 (GRCm39) D605N probably damaging Het
Pigb T A 9: 72,922,553 (GRCm39) R11* probably null Het
Prl8a1 C A 13: 27,758,007 (GRCm39) R234L probably benign Het
Spred3 T C 7: 28,866,059 (GRCm39) H80R probably damaging Het
Sptlc3 T C 2: 139,408,506 (GRCm39) I207T probably benign Het
Tll1 C A 8: 64,523,324 (GRCm39) G463* probably null Het
Tm4sf4 T G 3: 57,345,181 (GRCm39) C196G unknown Het
Tmem87a A T 2: 120,234,540 (GRCm39) M1K probably null Het
Tmem92 A G 11: 94,673,233 (GRCm39) L10P probably damaging Het
Trdn A T 10: 33,071,978 (GRCm39) E215V probably damaging Het
Trpm2 A T 10: 77,766,471 (GRCm39) D849E probably benign Het
Other mutations in Lepr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101,672,232 (GRCm39) missense probably benign
IGL01111:Lepr APN 4 101,671,852 (GRCm39) missense possibly damaging 0.77
IGL01324:Lepr APN 4 101,625,265 (GRCm39) missense probably benign 0.23
IGL01372:Lepr APN 4 101,592,774 (GRCm39) missense possibly damaging 0.67
IGL01626:Lepr APN 4 101,590,731 (GRCm39) missense probably benign 0.10
IGL01733:Lepr APN 4 101,622,279 (GRCm39) missense probably benign 0.00
IGL01815:Lepr APN 4 101,671,987 (GRCm39) missense possibly damaging 0.49
IGL01899:Lepr APN 4 101,637,184 (GRCm39) missense possibly damaging 0.86
IGL02138:Lepr APN 4 101,625,264 (GRCm39) missense probably damaging 0.98
IGL02161:Lepr APN 4 101,602,875 (GRCm39) missense probably damaging 0.97
IGL02653:Lepr APN 4 101,622,141 (GRCm39) missense probably benign 0.44
IGL02735:Lepr APN 4 101,639,835 (GRCm39) missense probably damaging 1.00
IGL03035:Lepr APN 4 101,622,177 (GRCm39) missense probably damaging 1.00
IGL03083:Lepr APN 4 101,671,876 (GRCm39) nonsense probably null
IGL03160:Lepr APN 4 101,622,103 (GRCm39) missense probably damaging 1.00
aufsetzigen UTSW 4 101,609,372 (GRCm39) missense probably damaging 1.00
beastly UTSW 4 101,671,788 (GRCm39) missense probably benign
business_class UTSW 4 101,622,069 (GRCm39) missense probably damaging 1.00
cherub UTSW 4 101,625,259 (GRCm39) missense probably benign 0.25
clodhopper UTSW 4 101,622,487 (GRCm39) splice site probably null
donner UTSW 4 101,672,398 (GRCm39) missense probably damaging 1.00
fluffy UTSW 4 101,649,220 (GRCm39) missense probably damaging 1.00
giant UTSW 4 101,622,349 (GRCm39) critical splice donor site probably null
gordo UTSW 4 101,622,502 (GRCm39) missense probably damaging 0.97
Immunoglutton UTSW 4 101,622,498 (GRCm39) splice site probably benign
Jumbo_shrimp UTSW 4 101,622,151 (GRCm39) nonsense probably null
lowleaning UTSW 4 101,671,588 (GRCm39) splice site probably null
odd UTSW 4 101,585,271 (GRCm39) splice site probably benign
paleo UTSW 4 101,602,842 (GRCm39) missense possibly damaging 0.94
R0140_Lepr_245 UTSW 4 101,625,264 (GRCm39) missense probably damaging 1.00
well-upholstered UTSW 4 101,630,155 (GRCm39) synonymous probably benign
worldly UTSW 4 101,625,425 (GRCm39) missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101,649,194 (GRCm39) missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101,637,180 (GRCm39) missense probably benign 0.10
R0140:Lepr UTSW 4 101,625,264 (GRCm39) missense probably damaging 1.00
R0197:Lepr UTSW 4 101,609,349 (GRCm39) missense possibly damaging 0.64
R0279:Lepr UTSW 4 101,607,541 (GRCm39) missense probably benign 0.05
R0487:Lepr UTSW 4 101,625,290 (GRCm39) nonsense probably null
R0498:Lepr UTSW 4 101,602,889 (GRCm39) missense probably benign 0.01
R0506:Lepr UTSW 4 101,630,207 (GRCm39) splice site probably benign
R0512:Lepr UTSW 4 101,671,901 (GRCm39) missense possibly damaging 0.87
R0512:Lepr UTSW 4 101,649,216 (GRCm39) missense probably damaging 1.00
R0726:Lepr UTSW 4 101,622,131 (GRCm39) missense probably benign 0.01
R1054:Lepr UTSW 4 101,639,793 (GRCm39) missense probably damaging 0.97
R1109:Lepr UTSW 4 101,628,552 (GRCm39) missense probably damaging 1.00
R1398:Lepr UTSW 4 101,649,216 (GRCm39) missense probably damaging 1.00
R1464:Lepr UTSW 4 101,592,878 (GRCm39) missense probably benign 0.08
R1464:Lepr UTSW 4 101,592,878 (GRCm39) missense probably benign 0.08
R1519:Lepr UTSW 4 101,646,541 (GRCm39) missense probably damaging 0.97
R1602:Lepr UTSW 4 101,602,842 (GRCm39) missense possibly damaging 0.94
R1830:Lepr UTSW 4 101,592,874 (GRCm39) missense probably damaging 1.00
R1850:Lepr UTSW 4 101,590,620 (GRCm39) missense possibly damaging 0.67
R1918:Lepr UTSW 4 101,630,033 (GRCm39) missense probably benign 0.08
R1928:Lepr UTSW 4 101,639,927 (GRCm39) splice site probably benign
R2099:Lepr UTSW 4 101,630,185 (GRCm39) missense probably damaging 1.00
R2102:Lepr UTSW 4 101,630,178 (GRCm39) missense possibly damaging 0.95
R2175:Lepr UTSW 4 101,622,576 (GRCm39) missense probably benign 0.01
R2254:Lepr UTSW 4 101,672,309 (GRCm39) missense probably benign 0.26
R2508:Lepr UTSW 4 101,648,093 (GRCm39) missense probably damaging 0.98
R2571:Lepr UTSW 4 101,625,369 (GRCm39) missense possibly damaging 0.96
R3790:Lepr UTSW 4 101,648,111 (GRCm39) splice site probably benign
R3882:Lepr UTSW 4 101,672,462 (GRCm39) missense probably damaging 1.00
R3933:Lepr UTSW 4 101,622,498 (GRCm39) splice site probably benign
R4211:Lepr UTSW 4 101,590,611 (GRCm39) missense probably benign 0.19
R4343:Lepr UTSW 4 101,622,349 (GRCm39) critical splice donor site probably null
R4345:Lepr UTSW 4 101,622,349 (GRCm39) critical splice donor site probably null
R4544:Lepr UTSW 4 101,625,425 (GRCm39) missense possibly damaging 0.96
R4546:Lepr UTSW 4 101,671,838 (GRCm39) missense probably benign 0.35
R4724:Lepr UTSW 4 101,622,562 (GRCm39) nonsense probably null
R4797:Lepr UTSW 4 101,637,244 (GRCm39) missense possibly damaging 0.90
R4860:Lepr UTSW 4 101,646,534 (GRCm39) missense probably benign 0.14
R4860:Lepr UTSW 4 101,646,534 (GRCm39) missense probably benign 0.14
R4929:Lepr UTSW 4 101,672,314 (GRCm39) missense probably benign 0.00
R4939:Lepr UTSW 4 101,590,635 (GRCm39) missense possibly damaging 0.78
R5377:Lepr UTSW 4 101,672,216 (GRCm39) missense possibly damaging 0.71
R5520:Lepr UTSW 4 101,602,734 (GRCm39) missense probably benign 0.00
R5966:Lepr UTSW 4 101,649,324 (GRCm39) intron probably benign
R6092:Lepr UTSW 4 101,649,220 (GRCm39) missense probably damaging 1.00
R6130:Lepr UTSW 4 101,622,569 (GRCm39) missense probably damaging 0.99
R6168:Lepr UTSW 4 101,592,789 (GRCm39) missense probably damaging 0.99
R6232:Lepr UTSW 4 101,671,588 (GRCm39) splice site probably null
R6380:Lepr UTSW 4 101,622,151 (GRCm39) nonsense probably null
R6427:Lepr UTSW 4 101,631,454 (GRCm39) missense possibly damaging 0.47
R6428:Lepr UTSW 4 101,637,295 (GRCm39) missense probably damaging 1.00
R6641:Lepr UTSW 4 101,622,502 (GRCm39) missense probably damaging 0.97
R6650:Lepr UTSW 4 101,672,398 (GRCm39) missense probably damaging 1.00
R6859:Lepr UTSW 4 101,622,487 (GRCm39) splice site probably null
R7023:Lepr UTSW 4 101,646,484 (GRCm39) missense probably damaging 1.00
R7145:Lepr UTSW 4 101,609,394 (GRCm39) missense probably benign 0.00
R7174:Lepr UTSW 4 101,607,535 (GRCm39) missense probably benign 0.01
R7179:Lepr UTSW 4 101,602,856 (GRCm39) missense probably benign 0.06
R7189:Lepr UTSW 4 101,671,961 (GRCm39) missense probably benign 0.00
R7426:Lepr UTSW 4 101,602,853 (GRCm39) missense probably benign 0.03
R7531:Lepr UTSW 4 101,609,372 (GRCm39) missense probably damaging 1.00
R7620:Lepr UTSW 4 101,609,270 (GRCm39) missense probably benign 0.41
R7804:Lepr UTSW 4 101,639,783 (GRCm39) missense probably damaging 1.00
R8022:Lepr UTSW 4 101,639,754 (GRCm39) missense probably benign 0.32
R8142:Lepr UTSW 4 101,622,616 (GRCm39) missense possibly damaging 0.93
R8227:Lepr UTSW 4 101,628,559 (GRCm39) missense probably damaging 0.99
R8426:Lepr UTSW 4 101,671,841 (GRCm39) missense probably benign 0.12
R8447:Lepr UTSW 4 101,671,688 (GRCm39) missense probably benign 0.08
R8531:Lepr UTSW 4 101,622,612 (GRCm39) missense probably damaging 1.00
R8682:Lepr UTSW 4 101,649,269 (GRCm39) missense probably benign 0.00
R8897:Lepr UTSW 4 101,649,233 (GRCm39) missense probably damaging 0.98
R9096:Lepr UTSW 4 101,631,418 (GRCm39) missense possibly damaging 0.95
R9177:Lepr UTSW 4 101,602,798 (GRCm39) nonsense probably null
R9241:Lepr UTSW 4 101,671,788 (GRCm39) missense probably benign
R9604:Lepr UTSW 4 101,590,473 (GRCm39) missense probably benign 0.01
R9711:Lepr UTSW 4 101,592,851 (GRCm39) nonsense probably null
X0026:Lepr UTSW 4 101,590,524 (GRCm39) missense possibly damaging 0.47
Z1176:Lepr UTSW 4 101,602,811 (GRCm39) missense probably damaging 0.99
Z1177:Lepr UTSW 4 101,592,792 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGGACCACCGAACAC -3'
(R):5'- GTTTCAGAGAGATTCTTAACCTGC -3'

Sequencing Primer
(F):5'- GAACACAACCGATGACTCCTTTCTC -3'
(R):5'- AGTGTGCATTTTCTACTTCCAAG -3'
Posted On 2014-11-11