Incidental Mutation 'R0302:Lonp2'
ID24852
Institutional Source Beutler Lab
Gene Symbol Lonp2
Ensembl Gene ENSMUSG00000047866
Gene Namelon peptidase 2, peroxisomal
Synonyms1300002A08Rik
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R0302 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location86624043-86723873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86637991 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 326 (T326A)
Ref Sequence ENSEMBL: ENSMUSP00000118737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034141] [ENSMUST00000122188] [ENSMUST00000155433]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034141
AA Change: T326A

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034141
Gene: ENSMUSG00000047866
AA Change: T326A

DomainStartEndE-ValueType
Pfam:LON_substr_bdg 12 220 1e-24 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Pfam:Lon_C 628 837 1.6e-83 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000122188
AA Change: T184A
SMART Domains Protein: ENSMUSP00000113834
Gene: ENSMUSG00000047866
AA Change: T184A

DomainStartEndE-ValueType
Pfam:LON 12 224 9e-17 PFAM
AAA 225 370 1.59e-10 SMART
low complexity region 396 403 N/A INTRINSIC
Pfam:Lon_C 486 695 1.5e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124911
Predicted Effect possibly damaging
Transcript: ENSMUST00000155433
AA Change: T326A

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118737
Gene: ENSMUSG00000047866
AA Change: T326A

DomainStartEndE-ValueType
Pfam:LON 12 220 3.3e-26 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155501
Meta Mutation Damage Score 0.1662 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, peroxisomes function primarily to catalyze fatty acid beta-oxidation and, as a by-product, produce hydrogen peroxide and superoxide. The protein encoded by this gene is an ATP-dependent protease that likely plays a role in maintaining overall peroxisome homeostasis as well as proteolytically degrading peroxisomal proteins damaged by oxidation. The protein has an N-terminal Lon N substrate recognition domain, an ATPase domain, a proteolytic domain, and, in some isoforms, a C-terminal peroxisome targeting sequence. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Zfr2 G T 10: 81,251,336 probably benign Het
Other mutations in Lonp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Lonp2 APN 8 86633972 missense probably damaging 1.00
IGL00990:Lonp2 APN 8 86641533 splice site probably benign
IGL01654:Lonp2 APN 8 86714086 missense probably damaging 1.00
IGL02021:Lonp2 APN 8 86708971 missense probably benign 0.00
IGL02165:Lonp2 APN 8 86709026 missense probably damaging 1.00
IGL02309:Lonp2 APN 8 86634863 missense probably damaging 1.00
IGL02355:Lonp2 APN 8 86624246 missense probably benign 0.17
IGL02362:Lonp2 APN 8 86624246 missense probably benign 0.17
IGL02365:Lonp2 APN 8 86716365 missense possibly damaging 0.69
IGL02374:Lonp2 APN 8 86709045 missense probably damaging 0.97
IGL02440:Lonp2 APN 8 86624185 start codon destroyed probably null 0.98
R0083:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0108:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0108:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0129:Lonp2 UTSW 8 86634890 missense probably damaging 0.99
R0433:Lonp2 UTSW 8 86633954 missense probably damaging 1.00
R1148:Lonp2 UTSW 8 86636540 missense probably benign 0.00
R1148:Lonp2 UTSW 8 86636540 missense probably benign 0.00
R1413:Lonp2 UTSW 8 86641584 missense probably damaging 1.00
R1589:Lonp2 UTSW 8 86673072 splice site probably benign
R1635:Lonp2 UTSW 8 86713450 missense possibly damaging 0.78
R1654:Lonp2 UTSW 8 86631450 missense probably damaging 0.99
R2033:Lonp2 UTSW 8 86708942 missense possibly damaging 0.77
R2062:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2065:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2066:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2068:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R4321:Lonp2 UTSW 8 86665728 missense probably damaging 1.00
R4713:Lonp2 UTSW 8 86713315 missense probably damaging 0.98
R4750:Lonp2 UTSW 8 86631502 missense probably benign 0.09
R5790:Lonp2 UTSW 8 86631490 missense probably benign 0.24
R5854:Lonp2 UTSW 8 86673071 critical splice donor site probably null
R5884:Lonp2 UTSW 8 86641626 missense probably damaging 1.00
R6025:Lonp2 UTSW 8 86713373 missense probably damaging 1.00
R6236:Lonp2 UTSW 8 86636587 nonsense probably null
R6481:Lonp2 UTSW 8 86634908 missense possibly damaging 0.69
R6534:Lonp2 UTSW 8 86716458 missense probably benign 0.00
R6805:Lonp2 UTSW 8 86709096 missense probably benign
R6983:Lonp2 UTSW 8 86624248 missense probably damaging 1.00
R7330:Lonp2 UTSW 8 86631394 missense probably damaging 1.00
R7641:Lonp2 UTSW 8 86665758 missense probably benign 0.02
R7674:Lonp2 UTSW 8 86665758 missense probably benign 0.02
R7711:Lonp2 UTSW 8 86714008 missense probably damaging 0.99
R7826:Lonp2 UTSW 8 86709013 missense probably damaging 1.00
R7999:Lonp2 UTSW 8 86634909 missense probably benign 0.02
R8057:Lonp2 UTSW 8 86714089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGGTAAGGAGACATGCTTGG -3'
(R):5'- ACAGTGCAGGTGATGCTGATGATG -3'

Sequencing Primer
(F):5'- AAGGAGACATGCTTGGTTTTTCTG -3'
(R):5'- AATCATGTGTGCAACTGCC -3'
Posted On2013-04-16