Mutagenetix > Incidental Mutations

Incidental Mutation 'R0302:Kifc3'

24853

Institutional Source

Beutler Lab

Gene Symbol

Kifc3

Ensembl Gene

ENSMUSG00000031788

Gene Name

kinesin family member C3

Synonyms

MMRRC Submission

038514-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0302 (G1)

Quality Score

179

Status

Validated

Chromosome

Chromosomal Location

95099828-95202812 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 95103470 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 557 (Q557K)

Ref Sequence

ENSEMBL: ENSMUSP00000126784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034239] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212968] [ENSMUST00000213004]

AlphaFold

O35231

Predicted Effect

probably benign
Transcript: ENSMUST00000034239

SMART Domains

Protein: ENSMUSP00000034239
Gene: ENSMUSG00000031787

Domain	Start	End	E-Value	Type
WD40	9	49	2.61e-3	SMART
WD40	52	91	2.45e-8	SMART
WD40	94	133	3.58e-10	SMART
WD40	136	175	7.49e-13	SMART
WD40	178	217	5.14e-11	SMART
WD40	220	258	1.14e-3	SMART
low complexity region	354	373	N/A	INTRINSIC
low complexity region	396	412	N/A	INTRINSIC
Pfam:Katanin_con80	496	654	8.2e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000034240
AA Change: Q603K

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788
AA Change: Q603K

Domain	Start	End	E-Value	Type
low complexity region	33	46	N/A	INTRINSIC
coiled coil region	100	360	N/A	INTRINSIC
coiled coil region	393	430	N/A	INTRINSIC
KISc	441	774	3.15e-158	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169353
AA Change: Q488K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788
AA Change: Q488K

Domain	Start	End	E-Value	Type
coiled coil region	33	223	N/A	INTRINSIC
coiled coil region	256	293	N/A	INTRINSIC
KISc	304	637	3.15e-158	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169748
AA Change: Q557K

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788
AA Change: Q557K

Domain	Start	End	E-Value	Type
coiled coil region	34	324	N/A	INTRINSIC
coiled coil region	357	394	N/A	INTRINSIC
KISc	405	728	3.11e-148	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211854

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212656

Predicted Effect

probably benign
Transcript: ENSMUST00000212968

Predicted Effect

probably benign
Transcript: ENSMUST00000213004
AA Change: Q466K

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.1364

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 95.1%
20x: 89.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and appear phenotypically indistinguishable from wild-type littermates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adprhl2	T	C	4: 126,317,392	E244G	probably benign	Het
Aldh1l2	G	A	10: 83,520,365	P54S	probably damaging	Het
Ankdd1a	G	A	9: 65,509,642		probably benign	Het
Ankra2	T	A	13: 98,271,692	S216R	probably damaging	Het
Asah2	A	T	19: 32,052,956	N105K	probably benign	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Cacna1s	A	G	1: 136,100,604	Y893C	probably benign	Het
Capza2	G	A	6: 17,648,524	R15H	probably benign	Het
Cbfa2t2	T	C	2: 154,534,876		probably benign	Het
Ccdc96	A	T	5: 36,486,101	T484S	possibly damaging	Het
Cckar	GCTTAGCCTCTTCT	GCT	5: 53,700,299		probably null	Het
Ccl4	T	A	11: 83,663,454		probably benign	Het
Cpt1b	A	G	15: 89,417,870	Y702H	probably benign	Het
Cr1l	G	A	1: 195,117,793	T153I	probably damaging	Het
Cyth2	C	A	7: 45,810,585	E57*	probably null	Het
Daxx	T	A	17: 33,913,620	S575T	probably damaging	Het
Depdc5	T	C	5: 32,904,546		probably benign	Het
Dnah12	A	G	14: 26,799,999	D1923G	probably damaging	Het
Dnah7b	A	G	1: 46,123,777	T428A	probably benign	Het
Dnm2	G	T	9: 21,500,343	A619S	probably benign	Het
Enpp2	T	C	15: 54,860,061	T639A	probably benign	Het
Epsti1	A	T	14: 77,939,926	H182L	probably damaging	Het
Exoc3l	C	T	8: 105,293,543	R250Q	probably benign	Het
Ggn	G	T	7: 29,171,240		probably null	Het
Il1rap	A	G	16: 26,692,794	N196S	probably benign	Het
Ints6	T	C	14: 62,709,512	T335A	probably damaging	Het
Itga1	G	A	13: 115,012,318		probably benign	Het
Krt23	A	G	11: 99,478,201	I422T	probably benign	Het
Lcn2	A	G	2: 32,384,889		probably benign	Het
Lonp2	A	G	8: 86,637,991	T326A	possibly damaging	Het
Lrpprc	T	C	17: 84,740,078	I909V	possibly damaging	Het
Lrrc14	G	T	15: 76,714,352	R396L	probably benign	Het
Lypd6	T	G	2: 50,165,667		probably benign	Het
Man2b1	A	G	8: 85,093,016	N610S	probably damaging	Het
Map2	A	T	1: 66,414,828	N959I	probably benign	Het
Mctp2	C	T	7: 72,090,264	V793I	possibly damaging	Het
Med25	A	C	7: 44,880,558		probably benign	Het
Mfsd6	T	C	1: 52,709,457	Y83C	probably damaging	Het
Mtbp	A	T	15: 55,625,424	M499L	probably damaging	Het
Mtmr10	A	T	7: 64,297,497	K53N	probably damaging	Het
Nfat5	T	C	8: 107,358,701	I542T	probably damaging	Het
Nr1h3	A	G	2: 91,192,013	M90T	probably damaging	Het
Nsmce4a	A	G	7: 130,545,893		probably benign	Het
Olfr1168	T	A	2: 88,185,510	I211N	possibly damaging	Het
Oprl1	G	A	2: 181,719,228	C318Y	probably benign	Het
Pbx3	A	T	2: 34,224,560	S46T	probably benign	Het
Pign	A	T	1: 105,589,093	F575I	possibly damaging	Het
Ptpn13	G	T	5: 103,565,225	S1738I	probably benign	Het
Rnf126	G	T	10: 79,759,223	P269Q	probably damaging	Het
Ryr3	G	A	2: 112,647,123		probably benign	Het
Slc2a7	C	T	4: 150,149,521	A31V	probably damaging	Het
Slc6a12	A	G	6: 121,363,259	D487G	probably damaging	Het
Son	G	T	16: 91,656,144	G593V	probably damaging	Het
Spata31d1a	T	C	13: 59,703,150	N388S	probably benign	Het
Spg11	A	T	2: 122,092,187	M927K	possibly damaging	Het
Taf13	A	G	3: 108,571,722	M1V	probably null	Het
Trim32	G	A	4: 65,613,254	R16Q	probably damaging	Het
Trio	A	G	15: 27,902,517	F286S	probably damaging	Het
Trpm2	A	C	10: 77,943,990		probably benign	Het
Ttc7b	T	C	12: 100,387,179	M390V	possibly damaging	Het
Vmn1r184	A	T	7: 26,267,543	Q238L	probably damaging	Het
Zfp236	T	C	18: 82,658,088	E368G	probably damaging	Het
Zfr2	G	T	10: 81,251,336		probably benign	Het

Other mutations in Kifc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00720:Kifc3	APN	8	95138016	missense	probably damaging	1.00
IGL01904:Kifc3	APN	8	95137957	missense	possibly damaging	0.81
IGL02019:Kifc3	APN	8	95107540	splice site	probably benign
IGL02090:Kifc3	APN	8	95102480	missense	probably damaging	1.00
IGL02355:Kifc3	APN	8	95109879	missense	probably damaging	1.00
IGL02362:Kifc3	APN	8	95109879	missense	probably damaging	1.00
IGL02620:Kifc3	APN	8	95109954	missense	probably damaging	0.98
IGL02720:Kifc3	APN	8	95108365	missense	probably benign	0.00
IGL03030:Kifc3	APN	8	95102412	missense	probably damaging	1.00
IGL03327:Kifc3	APN	8	95108432	missense	probably damaging	1.00
IGL03390:Kifc3	APN	8	95108613	missense	probably damaging	1.00
R0233:Kifc3	UTSW	8	95101472	splice site	probably null
R0281:Kifc3	UTSW	8	95103460	missense	probably damaging	1.00
R0619:Kifc3	UTSW	8	95102665	missense	probably benign	0.13
R0731:Kifc3	UTSW	8	95105733	missense	probably damaging	1.00
R1017:Kifc3	UTSW	8	95105785	missense	probably damaging	0.99
R1147:Kifc3	UTSW	8	95137918	missense	probably damaging	1.00
R1147:Kifc3	UTSW	8	95137918	missense	probably damaging	1.00
R1257:Kifc3	UTSW	8	95105772	missense	probably damaging	0.98
R1472:Kifc3	UTSW	8	95137913	critical splice donor site	probably null
R1480:Kifc3	UTSW	8	95109887	missense	probably damaging	1.00
R1553:Kifc3	UTSW	8	95106542	missense	possibly damaging	0.67
R2071:Kifc3	UTSW	8	95108353	critical splice donor site	probably null
R2115:Kifc3	UTSW	8	95108713	missense	probably damaging	1.00
R3703:Kifc3	UTSW	8	95104028	splice site	probably benign
R3704:Kifc3	UTSW	8	95104028	splice site	probably benign
R3705:Kifc3	UTSW	8	95104028	splice site	probably benign
R4223:Kifc3	UTSW	8	95109982	missense	probably damaging	0.96
R4463:Kifc3	UTSW	8	95102116	missense	probably damaging	1.00
R4508:Kifc3	UTSW	8	95107420	splice site	probably null
R4980:Kifc3	UTSW	8	95126549	missense	probably benign
R5032:Kifc3	UTSW	8	95102726	missense	probably damaging	1.00
R5068:Kifc3	UTSW	8	95110216	missense	possibly damaging	0.54
R5421:Kifc3	UTSW	8	95109845	missense	probably damaging	0.99
R5556:Kifc3	UTSW	8	95108459	nonsense	probably null
R6845:Kifc3	UTSW	8	95108679	missense	probably benign	0.28
R7136:Kifc3	UTSW	8	95103449	missense	probably benign	0.10
R7196:Kifc3	UTSW	8	95106611	missense	probably benign	0.02
R7404:Kifc3	UTSW	8	95103464	missense	probably benign	0.02
R7441:Kifc3	UTSW	8	95137987	missense	probably benign	0.00
R7784:Kifc3	UTSW	8	95110692	critical splice donor site	probably null
R7861:Kifc3	UTSW	8	95107537	critical splice acceptor site	probably null
R8440:Kifc3	UTSW	8	95109794	missense	possibly damaging	0.89
R8754:Kifc3	UTSW	8	95102396	missense	probably damaging	1.00
R8983:Kifc3	UTSW	8	95106476	missense	probably damaging	1.00
R9035:Kifc3	UTSW	8	95126567	missense	possibly damaging	0.52
R9149:Kifc3	UTSW	8	95126689	missense	probably benign
R9464:Kifc3	UTSW	8	95103994	missense	possibly damaging	0.61
X0023:Kifc3	UTSW	8	95109298	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCAATGCCACCCTATGTGCTTTAC -3'
(R):5'- TCCAGACTAGGGATTGGGTGCAAG -3'

Sequencing Primer
(F):5'- tccacctgcctctgtcc -3'
(R):5'- TTGGGTGCAAGGCAAGC -3'

Posted On

2013-04-16