Incidental Mutation 'R2396:Efemp1'
ID248532
Institutional Source Beutler Lab
Gene Symbol Efemp1
Ensembl Gene ENSMUSG00000020467
Gene Nameepidermal growth factor-containing fibulin-like extracellular matrix protein 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2396 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location28853204-28926743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28867941 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 140 (R140Q)
Ref Sequence ENSEMBL: ENSMUSP00000020759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020759
AA Change: R140Q

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020759
Gene: ENSMUSG00000020467
AA Change: R140Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EGF_like 44 76 9.53e-2 SMART
low complexity region 87 104 N/A INTRINSIC
EGF_CA 173 213 5.78e-11 SMART
EGF_CA 214 253 2.35e-11 SMART
EGF_CA 254 293 1.22e-9 SMART
EGF_CA 294 333 1.35e-11 SMART
EGF_like 334 378 3.49e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124103
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibulin family of extracellular matrix glycoproteins. Like all members of this family, the encoded protein contains tandemly repeated epidermal growth factor-like repeats followed by a C-terminus fibulin-type domain. This gene is upregulated in malignant gliomas and may play a role in the aggressive nature of these tumors. Mutations in this gene are associated with Doyne honeycomb retinal dystrophy. Alternatively spliced transcript variants that encode the same protein have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. Mice homozygous for a single amino acid substitution develop deposits below the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T C 5: 9,435,395 L519P possibly damaging Het
Adamtsl1 G A 4: 86,343,119 W1189* probably null Het
Col4a4 C G 1: 82,507,072 M491I unknown Het
Col5a1 C A 2: 27,986,729 D813E unknown Het
Cyp4b1 T C 4: 115,641,646 Y113C probably benign Het
Dmac1 A G 4: 75,278,221 F11L unknown Het
Dnah9 G T 11: 66,085,158 T1355K probably benign Het
Fndc3a T C 14: 72,683,683 D17G possibly damaging Het
Grm8 C T 6: 27,761,242 A328T probably damaging Het
Lepr C A 4: 101,733,528 A101E probably benign Het
Ncapg A G 5: 45,678,373 N382S probably benign Het
Olfr1026 T C 2: 85,923,925 I219T probably benign Het
Olfr1349 C A 7: 6,514,785 V215F probably damaging Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pigb T A 9: 73,015,271 R11* probably null Het
Prl8a1 C A 13: 27,574,024 R234L probably benign Het
Spred3 T C 7: 29,166,634 H80R probably damaging Het
Sptlc3 T C 2: 139,566,586 I207T probably benign Het
Tll1 C A 8: 64,070,290 G463* probably null Het
Tm4sf4 T G 3: 57,437,760 C196G unknown Het
Tmem87a A T 2: 120,404,059 M1K probably null Het
Tmem92 A G 11: 94,782,407 L10P probably damaging Het
Trdn A T 10: 33,195,982 E215V probably damaging Het
Trpm2 A T 10: 77,930,637 D849E probably benign Het
Other mutations in Efemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Efemp1 APN 11 28926223 missense probably benign 0.32
IGL01862:Efemp1 APN 11 28921428 missense probably damaging 0.97
IGL02568:Efemp1 APN 11 28916971 critical splice donor site probably null
IGL03175:Efemp1 APN 11 28926259 missense probably benign 0.04
IGL03014:Efemp1 UTSW 11 28926218 missense probably damaging 0.96
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0974:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R1678:Efemp1 UTSW 11 28916942 missense probably benign 0.00
R1701:Efemp1 UTSW 11 28921750 missense possibly damaging 0.68
R1831:Efemp1 UTSW 11 28921442 missense possibly damaging 0.91
R2016:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2017:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2024:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2025:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2027:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2084:Efemp1 UTSW 11 28915763 missense probably damaging 1.00
R4803:Efemp1 UTSW 11 28921795 missense possibly damaging 0.84
R4817:Efemp1 UTSW 11 28926241 missense probably damaging 1.00
R5201:Efemp1 UTSW 11 28914590 missense probably benign 0.05
R5297:Efemp1 UTSW 11 28867868 missense probably damaging 0.99
R5534:Efemp1 UTSW 11 28867758 missense probably damaging 1.00
R5839:Efemp1 UTSW 11 28921418 missense possibly damaging 0.95
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6314:Efemp1 UTSW 11 28914603 missense probably benign 0.12
R7067:Efemp1 UTSW 11 28867926 missense probably damaging 1.00
R7396:Efemp1 UTSW 11 28867501 missense possibly damaging 0.92
Z1177:Efemp1 UTSW 11 28867909 missense not run
Predicted Primers PCR Primer
(F):5'- TCTGCCTTCCTAAAACAGCC -3'
(R):5'- CGTAAAAGCCAGCTCTGTCC -3'

Sequencing Primer
(F):5'- TCCTAAAACAGCCCAAATTATTGTC -3'
(R):5'- ACTTGGCTGGATACTCGAAC -3'
Posted On2014-11-11