Incidental Mutation 'R2397:Fibcd1'
ID248539
Institutional Source Beutler Lab
Gene Symbol Fibcd1
Ensembl Gene ENSMUSG00000026841
Gene Namefibrinogen C domain containing 1
Synonyms
MMRRC Submission 040364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2397 (G1)
Quality Score224
Status Validated
Chromosome2
Chromosomal Location31813290-31846005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31834423 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 191 (M191K)
Ref Sequence ENSEMBL: ENSMUSP00000028188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028188]
Predicted Effect probably benign
Transcript: ENSMUST00000028188
AA Change: M191K

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028188
Gene: ENSMUSG00000026841
AA Change: M191K

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
Blast:FBG 196 236 8e-14 BLAST
FBG 237 455 1.21e-117 SMART
Meta Mutation Damage Score 0.5644 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FIBCD1 is a conserved type II transmembrane endocytic receptor that binds chitin and is located primarily in the intestinal brush border (Schlosser et al., 2009 [PubMed 19710473]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 T A 8: 55,872,898 M174L probably benign Het
Adamtsl1 C T 4: 86,199,357 R186W probably damaging Het
Agtpbp1 C T 13: 59,474,569 V948I probably benign Het
Atp13a2 A G 4: 141,003,155 T787A probably benign Het
Capn11 T A 17: 45,653,221 N139I probably damaging Het
Cars T C 7: 143,592,507 D60G possibly damaging Het
Cers1 A T 8: 70,321,536 I148F probably benign Het
Col14a1 T C 15: 55,338,439 I41T unknown Het
Cyp2d26 C T 15: 82,794,035 G47R probably damaging Het
Dhx36 A T 3: 62,498,097 M205K probably benign Het
Dyrk2 T A 10: 118,861,368 probably benign Het
Echs1 T C 7: 140,112,477 H119R possibly damaging Het
Ehf T A 2: 103,276,819 D120V probably damaging Het
Esrra A G 19: 6,920,176 L71P probably damaging Het
Fam228a A T 12: 4,718,718 S200R probably benign Het
Foxn4 A G 5: 114,255,495 L521P probably damaging Het
Fscn2 T C 11: 120,362,169 L154P probably damaging Het
Gm7964 T G 7: 83,757,113 noncoding transcript Het
Golga3 T C 5: 110,205,877 probably benign Het
Gria4 A G 9: 4,537,717 L197P probably damaging Het
Heg1 T A 16: 33,742,479 M913K probably damaging Het
Ifi205 T C 1: 174,017,575 T214A possibly damaging Het
Ift140 T G 17: 25,020,736 D122E probably damaging Het
Jakmip1 T A 5: 37,100,743 D244E probably damaging Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Mc2r T A 18: 68,408,153 D23V probably benign Het
Ncr1 T A 7: 4,338,261 F47I probably benign Het
Nr1h3 G A 2: 91,191,857 T142I possibly damaging Het
Obox2 C T 7: 15,397,046 P68S probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Parn A G 16: 13,566,654 V515A probably benign Het
Ptdss2 T A 7: 141,147,092 F105I probably benign Het
Ruvbl1 A C 6: 88,465,552 T9P possibly damaging Het
Slc15a3 A G 19: 10,843,043 E8G probably benign Het
Slf1 G T 13: 77,103,583 Y303* probably null Het
Socs5 T C 17: 87,134,949 F439S probably damaging Het
Tcp10c C A 17: 13,370,211 A357E probably damaging Het
Tmem200c T C 17: 68,840,947 V175A probably damaging Het
Vmn2r124 T A 17: 18,049,597 H38Q possibly damaging Het
Vmn2r54 T G 7: 12,615,651 Q668P probably damaging Het
Xrcc2 T C 5: 25,705,710 S3G probably null Het
Other mutations in Fibcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fibcd1 APN 2 31833874 missense possibly damaging 0.67
IGL01069:Fibcd1 APN 2 31821519 missense probably benign 0.37
IGL01606:Fibcd1 APN 2 31833853 missense probably benign 0.21
IGL02345:Fibcd1 APN 2 31816592 missense probably damaging 1.00
IGL02639:Fibcd1 APN 2 31817150 missense probably damaging 0.99
IGL02682:Fibcd1 APN 2 31838564 missense probably damaging 0.99
R0006:Fibcd1 UTSW 2 31838587 missense probably damaging 1.00
R1848:Fibcd1 UTSW 2 31821549 missense probably damaging 1.00
R1969:Fibcd1 UTSW 2 31816661 missense probably damaging 1.00
R2877:Fibcd1 UTSW 2 31838666 missense probably benign 0.12
R2878:Fibcd1 UTSW 2 31838666 missense probably benign 0.12
R2940:Fibcd1 UTSW 2 31817264 missense probably damaging 1.00
R4518:Fibcd1 UTSW 2 31817195 missense probably damaging 1.00
R5272:Fibcd1 UTSW 2 31816623 missense probably damaging 1.00
R5272:Fibcd1 UTSW 2 31816624 missense probably damaging 1.00
R5594:Fibcd1 UTSW 2 31838617 missense probably damaging 1.00
R7263:Fibcd1 UTSW 2 31817210 missense probably damaging 1.00
R7686:Fibcd1 UTSW 2 31833868 missense probably damaging 0.99
Z1176:Fibcd1 UTSW 2 31838539 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTCCATCTCCCTGAAACTGGG -3'
(R):5'- GAGTAGAAGTGGCCAAGCTTCC -3'

Sequencing Primer
(F):5'- GCACCAGAGCCACCCAG -3'
(R):5'- AAGCTTCCGCCTGAGCC -3'
Posted On2014-11-11