Incidental Mutation 'R2397:Ehf'
ID 248541
Institutional Source Beutler Lab
Gene Symbol Ehf
Ensembl Gene ENSMUSG00000012350
Gene Name ets homologous factor
Synonyms 9030625L19Rik
MMRRC Submission 040364-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.711) question?
Stock # R2397 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 103093776-103133620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103107164 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 120 (D120V)
Ref Sequence ENSEMBL: ENSMUSP00000118275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090475] [ENSMUST00000111174] [ENSMUST00000111176] [ENSMUST00000125788] [ENSMUST00000140503] [ENSMUST00000151265]
AlphaFold O70273
Predicted Effect probably damaging
Transcript: ENSMUST00000090475
AA Change: D120V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087961
Gene: ENSMUSG00000012350
AA Change: D120V

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111174
AA Change: D120V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106805
Gene: ENSMUSG00000012350
AA Change: D120V

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111176
AA Change: D120V

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106807
Gene: ENSMUSG00000012350
AA Change: D120V

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 183 270 1.84e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125788
AA Change: D131V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121103
Gene: ENSMUSG00000012350
AA Change: D131V

DomainStartEndE-ValueType
SAM_PNT 42 126 1.39e-35 SMART
PDB:3JTG|A 215 242 1e-8 PDB
Blast:ETS 217 242 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137774
Predicted Effect probably damaging
Transcript: ENSMUST00000140503
AA Change: D159V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114979
Gene: ENSMUSG00000012350
AA Change: D159V

DomainStartEndE-ValueType
SAM_PNT 70 154 1.39e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151265
AA Change: D120V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118275
Gene: ENSMUSG00000012350
AA Change: D120V

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
Meta Mutation Damage Score 0.2751 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 T A 8: 56,325,933 (GRCm39) M174L probably benign Het
Adamtsl1 C T 4: 86,117,594 (GRCm39) R186W probably damaging Het
Agtpbp1 C T 13: 59,622,383 (GRCm39) V948I probably benign Het
Atp13a2 A G 4: 140,730,466 (GRCm39) T787A probably benign Het
Capn11 T A 17: 45,964,147 (GRCm39) N139I probably damaging Het
Cars1 T C 7: 143,146,244 (GRCm39) D60G possibly damaging Het
Cers1 A T 8: 70,774,186 (GRCm39) I148F probably benign Het
Col14a1 T C 15: 55,201,835 (GRCm39) I41T unknown Het
Cyp2d26 C T 15: 82,678,236 (GRCm39) G47R probably damaging Het
Dhx36 A T 3: 62,405,518 (GRCm39) M205K probably benign Het
Dyrk2 T A 10: 118,697,273 (GRCm39) probably benign Het
Echs1 T C 7: 139,692,390 (GRCm39) H119R possibly damaging Het
Esrra A G 19: 6,897,544 (GRCm39) L71P probably damaging Het
Fam228a A T 12: 4,768,718 (GRCm39) S200R probably benign Het
Fibcd1 A T 2: 31,724,435 (GRCm39) M191K probably benign Het
Foxn4 A G 5: 114,393,556 (GRCm39) L521P probably damaging Het
Fscn2 T C 11: 120,252,995 (GRCm39) L154P probably damaging Het
Gm7964 T G 7: 83,406,321 (GRCm39) noncoding transcript Het
Golga3 T C 5: 110,353,743 (GRCm39) probably benign Het
Gria4 A G 9: 4,537,717 (GRCm39) L197P probably damaging Het
Heg1 T A 16: 33,562,849 (GRCm39) M913K probably damaging Het
Ifi205 T C 1: 173,845,141 (GRCm39) T214A possibly damaging Het
Ift140 T G 17: 25,239,710 (GRCm39) D122E probably damaging Het
Jakmip1 T A 5: 37,258,087 (GRCm39) D244E probably damaging Het
Krt84 A G 15: 101,438,689 (GRCm39) V266A probably benign Het
Mc2r T A 18: 68,541,224 (GRCm39) D23V probably benign Het
Ncr1 T A 7: 4,341,260 (GRCm39) F47I probably benign Het
Nr1h3 G A 2: 91,022,202 (GRCm39) T142I possibly damaging Het
Obox2 C T 7: 15,130,971 (GRCm39) P68S probably benign Het
Pacs2 G A 12: 113,026,987 (GRCm39) D605N probably damaging Het
Parn A G 16: 13,384,518 (GRCm39) V515A probably benign Het
Ptdss2 T A 7: 140,727,005 (GRCm39) F105I probably benign Het
Ruvbl1 A C 6: 88,442,534 (GRCm39) T9P possibly damaging Het
Slc15a3 A G 19: 10,820,407 (GRCm39) E8G probably benign Het
Slf1 G T 13: 77,251,702 (GRCm39) Y303* probably null Het
Socs5 T C 17: 87,442,377 (GRCm39) F439S probably damaging Het
Tcp10c C A 17: 13,590,473 (GRCm39) A357E probably damaging Het
Tmem200c T C 17: 69,147,942 (GRCm39) V175A probably damaging Het
Vmn2r124 T A 17: 18,269,859 (GRCm39) H38Q possibly damaging Het
Vmn2r54 T G 7: 12,349,578 (GRCm39) Q668P probably damaging Het
Xrcc2 T C 5: 25,910,708 (GRCm39) S3G probably null Het
Other mutations in Ehf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Ehf APN 2 103,097,185 (GRCm39) splice site probably null
IGL01296:Ehf APN 2 103,098,500 (GRCm39) splice site probably null
IGL02095:Ehf APN 2 103,097,336 (GRCm39) missense probably damaging 1.00
R0399:Ehf UTSW 2 103,097,215 (GRCm39) missense probably damaging 1.00
R1116:Ehf UTSW 2 103,097,354 (GRCm39) missense probably damaging 1.00
R1728:Ehf UTSW 2 103,104,251 (GRCm39) missense possibly damaging 0.51
R1729:Ehf UTSW 2 103,104,251 (GRCm39) missense possibly damaging 0.51
R2240:Ehf UTSW 2 103,104,420 (GRCm39) missense probably benign
R2287:Ehf UTSW 2 103,097,469 (GRCm39) missense possibly damaging 0.89
R4094:Ehf UTSW 2 103,121,095 (GRCm39) intron probably benign
R4687:Ehf UTSW 2 103,097,471 (GRCm39) missense probably damaging 1.00
R4930:Ehf UTSW 2 103,097,202 (GRCm39) missense probably damaging 1.00
R5695:Ehf UTSW 2 103,097,124 (GRCm39) missense probably damaging 1.00
R5925:Ehf UTSW 2 103,097,338 (GRCm39) splice site probably null
R6656:Ehf UTSW 2 103,113,928 (GRCm39) missense probably damaging 1.00
R8217:Ehf UTSW 2 103,109,976 (GRCm39) missense possibly damaging 0.94
R9008:Ehf UTSW 2 103,097,173 (GRCm39) missense
Z1176:Ehf UTSW 2 103,109,863 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CACTAGACTGAATTGGTGGTCC -3'
(R):5'- AGAGATGGTCCCAGGCTTTG -3'

Sequencing Primer
(F):5'- TGGTGGTCCCAAGGTCAAG -3'
(R):5'- TTTGATGTGCCGAGACTCACCAG -3'
Posted On 2014-11-11