Incidental Mutation 'R2397:Golga3'
ID 248547
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Name golgi autoantigen, golgin subfamily a, 3
Synonyms repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
MMRRC Submission 040364-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2397 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 110176701-110226470 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 110205877 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031477
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199123
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 T A 8: 55,872,898 (GRCm38) M174L probably benign Het
Adamtsl1 C T 4: 86,199,357 (GRCm38) R186W probably damaging Het
Agtpbp1 C T 13: 59,474,569 (GRCm38) V948I probably benign Het
Atp13a2 A G 4: 141,003,155 (GRCm38) T787A probably benign Het
Capn11 T A 17: 45,653,221 (GRCm38) N139I probably damaging Het
Cars T C 7: 143,592,507 (GRCm38) D60G possibly damaging Het
Cers1 A T 8: 70,321,536 (GRCm38) I148F probably benign Het
Col14a1 T C 15: 55,338,439 (GRCm38) I41T unknown Het
Cyp2d26 C T 15: 82,794,035 (GRCm38) G47R probably damaging Het
Dhx36 A T 3: 62,498,097 (GRCm38) M205K probably benign Het
Dyrk2 T A 10: 118,861,368 (GRCm38) probably benign Het
Echs1 T C 7: 140,112,477 (GRCm38) H119R possibly damaging Het
Ehf T A 2: 103,276,819 (GRCm38) D120V probably damaging Het
Esrra A G 19: 6,920,176 (GRCm38) L71P probably damaging Het
Fam228a A T 12: 4,718,718 (GRCm38) S200R probably benign Het
Fibcd1 A T 2: 31,834,423 (GRCm38) M191K probably benign Het
Foxn4 A G 5: 114,255,495 (GRCm38) L521P probably damaging Het
Fscn2 T C 11: 120,362,169 (GRCm38) L154P probably damaging Het
Gm7964 T G 7: 83,757,113 (GRCm38) noncoding transcript Het
Gria4 A G 9: 4,537,717 (GRCm38) L197P probably damaging Het
Heg1 T A 16: 33,742,479 (GRCm38) M913K probably damaging Het
Ifi205 T C 1: 174,017,575 (GRCm38) T214A possibly damaging Het
Ift140 T G 17: 25,020,736 (GRCm38) D122E probably damaging Het
Jakmip1 T A 5: 37,100,743 (GRCm38) D244E probably damaging Het
Krt84 A G 15: 101,530,254 (GRCm38) V266A probably benign Het
Mc2r T A 18: 68,408,153 (GRCm38) D23V probably benign Het
Ncr1 T A 7: 4,338,261 (GRCm38) F47I probably benign Het
Nr1h3 G A 2: 91,191,857 (GRCm38) T142I possibly damaging Het
Obox2 C T 7: 15,397,046 (GRCm38) P68S probably benign Het
Pacs2 G A 12: 113,063,367 (GRCm38) D605N probably damaging Het
Parn A G 16: 13,566,654 (GRCm38) V515A probably benign Het
Ptdss2 T A 7: 141,147,092 (GRCm38) F105I probably benign Het
Ruvbl1 A C 6: 88,465,552 (GRCm38) T9P possibly damaging Het
Slc15a3 A G 19: 10,843,043 (GRCm38) E8G probably benign Het
Slf1 G T 13: 77,103,583 (GRCm38) Y303* probably null Het
Socs5 T C 17: 87,134,949 (GRCm38) F439S probably damaging Het
Tcp10c C A 17: 13,370,211 (GRCm38) A357E probably damaging Het
Tmem200c T C 17: 68,840,947 (GRCm38) V175A probably damaging Het
Vmn2r124 T A 17: 18,049,597 (GRCm38) H38Q possibly damaging Het
Vmn2r54 T G 7: 12,615,651 (GRCm38) Q668P probably damaging Het
Xrcc2 T C 5: 25,705,710 (GRCm38) S3G probably null Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110,220,887 (GRCm38) missense probably damaging 1.00
IGL00594:Golga3 APN 5 110,204,975 (GRCm38) missense probably benign 0.37
IGL00672:Golga3 APN 5 110,212,244 (GRCm38) missense probably damaging 1.00
IGL00821:Golga3 APN 5 110,204,933 (GRCm38) missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110,187,717 (GRCm38) missense probably benign 0.04
IGL01408:Golga3 APN 5 110,217,809 (GRCm38) critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110,192,905 (GRCm38) critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110,188,746 (GRCm38) missense probably benign 0.26
cles UTSW 5 110,188,707 (GRCm38) nonsense probably null
tenta UTSW 5 110,218,130 (GRCm38) nonsense probably null
PIT4544001:Golga3 UTSW 5 110,188,690 (GRCm38) missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110,202,777 (GRCm38) missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110,202,777 (GRCm38) missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110,188,743 (GRCm38) missense probably damaging 1.00
R1219:Golga3 UTSW 5 110,184,349 (GRCm38) nonsense probably null
R1297:Golga3 UTSW 5 110,204,843 (GRCm38) missense probably benign 0.04
R1299:Golga3 UTSW 5 110,204,843 (GRCm38) missense probably benign 0.04
R1465:Golga3 UTSW 5 110,209,878 (GRCm38) missense probably damaging 1.00
R1465:Golga3 UTSW 5 110,209,878 (GRCm38) missense probably damaging 1.00
R1589:Golga3 UTSW 5 110,181,783 (GRCm38) missense probably damaging 1.00
R1795:Golga3 UTSW 5 110,207,627 (GRCm38) missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110,192,973 (GRCm38) missense probably damaging 0.96
R2116:Golga3 UTSW 5 110,187,395 (GRCm38) missense probably damaging 0.97
R2130:Golga3 UTSW 5 110,202,939 (GRCm38) critical splice donor site probably null
R2153:Golga3 UTSW 5 110,187,990 (GRCm38) splice site probably null
R2158:Golga3 UTSW 5 110,187,361 (GRCm38) missense probably damaging 1.00
R2357:Golga3 UTSW 5 110,202,648 (GRCm38) missense probably damaging 1.00
R2418:Golga3 UTSW 5 110,201,868 (GRCm38) missense probably damaging 1.00
R2495:Golga3 UTSW 5 110,207,596 (GRCm38) missense probably damaging 0.99
R2763:Golga3 UTSW 5 110,204,895 (GRCm38) missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110,201,998 (GRCm38) splice site probably benign
R3614:Golga3 UTSW 5 110,220,908 (GRCm38) missense probably damaging 1.00
R4520:Golga3 UTSW 5 110,203,751 (GRCm38) nonsense probably null
R5001:Golga3 UTSW 5 110,205,777 (GRCm38) missense probably damaging 1.00
R5046:Golga3 UTSW 5 110,192,940 (GRCm38) missense probably damaging 0.99
R5157:Golga3 UTSW 5 110,202,671 (GRCm38) missense probably benign 0.00
R5191:Golga3 UTSW 5 110,184,307 (GRCm38) intron probably benign
R5376:Golga3 UTSW 5 110,220,945 (GRCm38) critical splice donor site probably null
R5399:Golga3 UTSW 5 110,205,024 (GRCm38) missense probably damaging 0.96
R5407:Golga3 UTSW 5 110,201,990 (GRCm38) nonsense probably null
R5884:Golga3 UTSW 5 110,216,895 (GRCm38) missense probably damaging 1.00
R6087:Golga3 UTSW 5 110,204,946 (GRCm38) missense probably damaging 0.99
R6526:Golga3 UTSW 5 110,204,895 (GRCm38) missense probably damaging 0.98
R6651:Golga3 UTSW 5 110,218,130 (GRCm38) nonsense probably null
R7041:Golga3 UTSW 5 110,208,584 (GRCm38) critical splice donor site probably null
R7057:Golga3 UTSW 5 110,188,663 (GRCm38) missense probably damaging 1.00
R7078:Golga3 UTSW 5 110,193,087 (GRCm38) missense probably damaging 0.99
R7114:Golga3 UTSW 5 110,202,712 (GRCm38) missense probably benign 0.01
R7190:Golga3 UTSW 5 110,209,855 (GRCm38) missense probably damaging 1.00
R7405:Golga3 UTSW 5 110,208,446 (GRCm38) missense probably damaging 0.97
R7528:Golga3 UTSW 5 110,212,232 (GRCm38) missense probably damaging 1.00
R7638:Golga3 UTSW 5 110,205,828 (GRCm38) missense probably benign
R7760:Golga3 UTSW 5 110,205,850 (GRCm38) missense probably benign 0.39
R8099:Golga3 UTSW 5 110,188,707 (GRCm38) nonsense probably null
R8144:Golga3 UTSW 5 110,185,879 (GRCm38) missense probably damaging 0.99
R8558:Golga3 UTSW 5 110,208,555 (GRCm38) missense possibly damaging 0.83
R8708:Golga3 UTSW 5 110,202,855 (GRCm38) missense probably benign 0.05
R8887:Golga3 UTSW 5 110,205,760 (GRCm38) intron probably benign
R9039:Golga3 UTSW 5 110,204,933 (GRCm38) missense probably benign 0.00
R9045:Golga3 UTSW 5 110,193,097 (GRCm38) missense probably benign 0.00
R9057:Golga3 UTSW 5 110,184,599 (GRCm38) missense probably damaging 1.00
R9100:Golga3 UTSW 5 110,189,678 (GRCm38) missense probably benign 0.31
R9112:Golga3 UTSW 5 110,185,891 (GRCm38) missense probably benign 0.08
R9198:Golga3 UTSW 5 110,207,753 (GRCm38) missense probably benign 0.11
R9755:Golga3 UTSW 5 110,192,981 (GRCm38) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TCGCTAGGAAGTGTTGTCATC -3'
(R):5'- CTTCTGTAAAGGATGCTTGAGC -3'

Sequencing Primer
(F):5'- GACAGATATCTGGAGTAGGTG -3'
(R):5'- CCAGGCTGCTCAAGTTTA -3'
Posted On 2014-11-11