Incidental Mutation 'R2397:Fam228a'
ID248563
Institutional Source Beutler Lab
Gene Symbol Fam228a
Ensembl Gene ENSMUSG00000079177
Gene Namefamily with sequence similarity 228, member A
Synonyms
MMRRC Submission 040364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2397 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4713670-4738430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4718718 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 200 (S200R)
Ref Sequence ENSEMBL: ENSMUSP00000152506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000111154] [ENSMUST00000220311] [ENSMUST00000220978] [ENSMUST00000222363]
Predicted Effect probably benign
Transcript: ENSMUST00000062580
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111154
AA Change: S200R

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect probably benign
Transcript: ENSMUST00000220311
Predicted Effect probably benign
Transcript: ENSMUST00000220978
AA Change: S187R

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000222363
AA Change: S200R

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1358 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 T A 8: 55,872,898 M174L probably benign Het
Adamtsl1 C T 4: 86,199,357 R186W probably damaging Het
Agtpbp1 C T 13: 59,474,569 V948I probably benign Het
Atp13a2 A G 4: 141,003,155 T787A probably benign Het
Capn11 T A 17: 45,653,221 N139I probably damaging Het
Cars T C 7: 143,592,507 D60G possibly damaging Het
Cers1 A T 8: 70,321,536 I148F probably benign Het
Col14a1 T C 15: 55,338,439 I41T unknown Het
Cyp2d26 C T 15: 82,794,035 G47R probably damaging Het
Dhx36 A T 3: 62,498,097 M205K probably benign Het
Dyrk2 T A 10: 118,861,368 probably benign Het
Echs1 T C 7: 140,112,477 H119R possibly damaging Het
Ehf T A 2: 103,276,819 D120V probably damaging Het
Esrra A G 19: 6,920,176 L71P probably damaging Het
Fibcd1 A T 2: 31,834,423 M191K probably benign Het
Foxn4 A G 5: 114,255,495 L521P probably damaging Het
Fscn2 T C 11: 120,362,169 L154P probably damaging Het
Gm7964 T G 7: 83,757,113 noncoding transcript Het
Golga3 T C 5: 110,205,877 probably benign Het
Gria4 A G 9: 4,537,717 L197P probably damaging Het
Heg1 T A 16: 33,742,479 M913K probably damaging Het
Ifi205 T C 1: 174,017,575 T214A possibly damaging Het
Ift140 T G 17: 25,020,736 D122E probably damaging Het
Jakmip1 T A 5: 37,100,743 D244E probably damaging Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Mc2r T A 18: 68,408,153 D23V probably benign Het
Ncr1 T A 7: 4,338,261 F47I probably benign Het
Nr1h3 G A 2: 91,191,857 T142I possibly damaging Het
Obox2 C T 7: 15,397,046 P68S probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Parn A G 16: 13,566,654 V515A probably benign Het
Ptdss2 T A 7: 141,147,092 F105I probably benign Het
Ruvbl1 A C 6: 88,465,552 T9P possibly damaging Het
Slc15a3 A G 19: 10,843,043 E8G probably benign Het
Slf1 G T 13: 77,103,583 Y303* probably null Het
Socs5 T C 17: 87,134,949 F439S probably damaging Het
Tcp10c C A 17: 13,370,211 A357E probably damaging Het
Tmem200c T C 17: 68,840,947 V175A probably damaging Het
Vmn2r124 T A 17: 18,049,597 H38Q possibly damaging Het
Vmn2r54 T G 7: 12,615,651 Q668P probably damaging Het
Xrcc2 T C 5: 25,705,710 S3G probably null Het
Other mutations in Fam228a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Fam228a APN 12 4732773 missense possibly damaging 0.94
IGL01472:Fam228a APN 12 4715610 missense possibly damaging 0.64
IGL02602:Fam228a APN 12 4732808 missense probably benign 0.00
IGL02797:Fam228a APN 12 4731484 missense probably damaging 1.00
IGL03247:Fam228a APN 12 4737734 missense probably damaging 1.00
R0332:Fam228a UTSW 12 4735018 missense probably damaging 1.00
R0437:Fam228a UTSW 12 4732759 missense probably damaging 1.00
R0454:Fam228a UTSW 12 4731457 missense probably damaging 1.00
R0838:Fam228a UTSW 12 4735002 missense possibly damaging 0.92
R1791:Fam228a UTSW 12 4732748 missense probably damaging 1.00
R1836:Fam228a UTSW 12 4715620 missense probably damaging 1.00
R2256:Fam228a UTSW 12 4737775 start gained probably benign
R2257:Fam228a UTSW 12 4737775 start gained probably benign
R3731:Fam228a UTSW 12 4718671 missense probably benign 0.44
R3921:Fam228a UTSW 12 4731506 missense probably benign 0.02
R5937:Fam228a UTSW 12 4737725 missense probably damaging 1.00
R7278:Fam228a UTSW 12 4732790 missense probably benign 0.01
R7610:Fam228a UTSW 12 4731423 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGGTATTGCAAACCTCGCC -3'
(R):5'- TCAGACTTCAGCAACTCTACTC -3'

Sequencing Primer
(F):5'- GTATTGCAAACCTCGCCCAACC -3'
(R):5'- ATCCTTAAGGTCCACAGCATTC -3'
Posted On2014-11-11