Mutagenetix > Incidental Mutation

Incidental Mutation 'R0302:Trpm2'

24857

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

038514-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R0302 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to C at 77943990 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105400

Predicted Effect

probably benign
Transcript: ENSMUST00000105401

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 95.1%
20x: 89.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adprhl2	T	C	4: 126,317,392	E244G	probably benign	Het
Aldh1l2	G	A	10: 83,520,365	P54S	probably damaging	Het
Ankdd1a	G	A	9: 65,509,642		probably benign	Het
Ankra2	T	A	13: 98,271,692	S216R	probably damaging	Het
Asah2	A	T	19: 32,052,956	N105K	probably benign	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Cacna1s	A	G	1: 136,100,604	Y893C	probably benign	Het
Capza2	G	A	6: 17,648,524	R15H	probably benign	Het
Cbfa2t2	T	C	2: 154,534,876		probably benign	Het
Ccdc96	A	T	5: 36,486,101	T484S	possibly damaging	Het
Cckar	GCTTAGCCTCTTCT	GCT	5: 53,700,299		probably null	Het
Ccl4	T	A	11: 83,663,454		probably benign	Het
Cpt1b	A	G	15: 89,417,870	Y702H	probably benign	Het
Cr1l	G	A	1: 195,117,793	T153I	probably damaging	Het
Cyth2	C	A	7: 45,810,585	E57*	probably null	Het
Daxx	T	A	17: 33,913,620	S575T	probably damaging	Het
Depdc5	T	C	5: 32,904,546		probably benign	Het
Dnah12	A	G	14: 26,799,999	D1923G	probably damaging	Het
Dnah7b	A	G	1: 46,123,777	T428A	probably benign	Het
Dnm2	G	T	9: 21,500,343	A619S	probably benign	Het
Enpp2	T	C	15: 54,860,061	T639A	probably benign	Het
Epsti1	A	T	14: 77,939,926	H182L	probably damaging	Het
Exoc3l	C	T	8: 105,293,543	R250Q	probably benign	Het
Ggn	G	T	7: 29,171,240		probably null	Het
Il1rap	A	G	16: 26,692,794	N196S	probably benign	Het
Ints6	T	C	14: 62,709,512	T335A	probably damaging	Het
Itga1	G	A	13: 115,012,318		probably benign	Het
Kifc3	G	T	8: 95,103,470	Q557K	possibly damaging	Het
Krt23	A	G	11: 99,478,201	I422T	probably benign	Het
Lcn2	A	G	2: 32,384,889		probably benign	Het
Lonp2	A	G	8: 86,637,991	T326A	possibly damaging	Het
Lrpprc	T	C	17: 84,740,078	I909V	possibly damaging	Het
Lrrc14	G	T	15: 76,714,352	R396L	probably benign	Het
Lypd6	T	G	2: 50,165,667		probably benign	Het
Man2b1	A	G	8: 85,093,016	N610S	probably damaging	Het
Map2	A	T	1: 66,414,828	N959I	probably benign	Het
Mctp2	C	T	7: 72,090,264	V793I	possibly damaging	Het
Med25	A	C	7: 44,880,558		probably benign	Het
Mfsd6	T	C	1: 52,709,457	Y83C	probably damaging	Het
Mtbp	A	T	15: 55,625,424	M499L	probably damaging	Het
Mtmr10	A	T	7: 64,297,497	K53N	probably damaging	Het
Nfat5	T	C	8: 107,358,701	I542T	probably damaging	Het
Nr1h3	A	G	2: 91,192,013	M90T	probably damaging	Het
Nsmce4a	A	G	7: 130,545,893		probably benign	Het
Olfr1168	T	A	2: 88,185,510	I211N	possibly damaging	Het
Oprl1	G	A	2: 181,719,228	C318Y	probably benign	Het
Pbx3	A	T	2: 34,224,560	S46T	probably benign	Het
Pign	A	T	1: 105,589,093	F575I	possibly damaging	Het
Ptpn13	G	T	5: 103,565,225	S1738I	probably benign	Het
Rnf126	G	T	10: 79,759,223	P269Q	probably damaging	Het
Ryr3	G	A	2: 112,647,123		probably benign	Het
Slc2a7	C	T	4: 150,149,521	A31V	probably damaging	Het
Slc6a12	A	G	6: 121,363,259	D487G	probably damaging	Het
Son	G	T	16: 91,656,144	G593V	probably damaging	Het
Spata31d1a	T	C	13: 59,703,150	N388S	probably benign	Het
Spg11	A	T	2: 122,092,187	M927K	possibly damaging	Het
Taf13	A	G	3: 108,571,722	M1V	probably null	Het
Trim32	G	A	4: 65,613,254	R16Q	probably damaging	Het
Trio	A	G	15: 27,902,517	F286S	probably damaging	Het
Ttc7b	T	C	12: 100,387,179	M390V	possibly damaging	Het
Vmn1r184	A	T	7: 26,267,543	Q238L	probably damaging	Het
Zfp236	T	C	18: 82,658,088	E368G	probably damaging	Het
Zfr2	G	T	10: 81,251,336		probably benign	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77947897	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77936002	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77966025	nonsense	probably null
R8340:Trpm2	UTSW	10	77923624	nonsense	probably null
R8354:Trpm2	UTSW	10	77933649	missense	probably damaging	1.00
R8427:Trpm2	UTSW	10	77911402	missense	possibly damaging	0.93
R8445:Trpm2	UTSW	10	77910252	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77932294	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77929288	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77941180	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77942942	nonsense	probably null
R9319:Trpm2	UTSW	10	77949198	missense	probably damaging	1.00
R9381:Trpm2	UTSW	10	77911357	missense	possibly damaging	0.90
R9457:Trpm2	UTSW	10	77911392	missense	possibly damaging	0.82
R9477:Trpm2	UTSW	10	77911390	missense	probably benign	0.12
R9547:Trpm2	UTSW	10	77912633	missense	probably benign	0.33
R9660:Trpm2	UTSW	10	77930555	missense	probably benign	0.00
R9663:Trpm2	UTSW	10	77920486	missense	probably benign	0.01
Z1177:Trpm2	UTSW	10	77937868	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGATGGCACCAGATTCTAGCCAAAG -3'
(R):5'- ACAATTCAATCAGGATGGGGTAGATGC -3'

Sequencing Primer
(F):5'- TTCCTCAAAAGCATCTACCAGTC -3'
(R):5'- ttgaactctcctggaactcac -3'

Posted On

2013-04-16