Incidental Mutation 'R2397:Capn11'
ID248575
Institutional Source Beutler Lab
Gene Symbol Capn11
Ensembl Gene ENSMUSG00000058626
Gene Namecalpain 11
Synonyms
MMRRC Submission 040364-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2397 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location45630204-45659325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45653221 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 139 (N139I)
Ref Sequence ENSEMBL: ENSMUSP00000119679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120717] [ENSMUST00000151350]
Predicted Effect probably damaging
Transcript: ENSMUST00000120717
AA Change: N100I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113132
Gene: ENSMUSG00000058626
AA Change: N100I

DomainStartEndE-ValueType
CysPc 37 362 2.75e-157 SMART
calpain_III 366 523 2.57e-84 SMART
EFh 590 618 3.91e-4 SMART
EFh 620 648 6.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151350
AA Change: N139I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119679
Gene: ENSMUSG00000058626
AA Change: N139I

DomainStartEndE-ValueType
Pfam:Peptidase_C2 94 153 1.5e-14 PFAM
low complexity region 163 174 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains constitute a family of intracellular calcium-dependent cysteine proteases. There are eight members in this superfamily. They consist of a variable 80 kDa subunit and an invariant 30 kDa subunit. This calpain protein appears to have protease activity and calcium-binding ability. A similar mouse protein may play a functional role in spermatogenesis and in the regulation of calcium-dependent signal transduction events during meiosis. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 T A 8: 55,872,898 M174L probably benign Het
Adamtsl1 C T 4: 86,199,357 R186W probably damaging Het
Agtpbp1 C T 13: 59,474,569 V948I probably benign Het
Atp13a2 A G 4: 141,003,155 T787A probably benign Het
Cars T C 7: 143,592,507 D60G possibly damaging Het
Cers1 A T 8: 70,321,536 I148F probably benign Het
Col14a1 T C 15: 55,338,439 I41T unknown Het
Cyp2d26 C T 15: 82,794,035 G47R probably damaging Het
Dhx36 A T 3: 62,498,097 M205K probably benign Het
Dyrk2 T A 10: 118,861,368 probably benign Het
Echs1 T C 7: 140,112,477 H119R possibly damaging Het
Ehf T A 2: 103,276,819 D120V probably damaging Het
Esrra A G 19: 6,920,176 L71P probably damaging Het
Fam228a A T 12: 4,718,718 S200R probably benign Het
Fibcd1 A T 2: 31,834,423 M191K probably benign Het
Foxn4 A G 5: 114,255,495 L521P probably damaging Het
Fscn2 T C 11: 120,362,169 L154P probably damaging Het
Gm7964 T G 7: 83,757,113 noncoding transcript Het
Golga3 T C 5: 110,205,877 probably benign Het
Gria4 A G 9: 4,537,717 L197P probably damaging Het
Heg1 T A 16: 33,742,479 M913K probably damaging Het
Ifi205 T C 1: 174,017,575 T214A possibly damaging Het
Ift140 T G 17: 25,020,736 D122E probably damaging Het
Jakmip1 T A 5: 37,100,743 D244E probably damaging Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Mc2r T A 18: 68,408,153 D23V probably benign Het
Ncr1 T A 7: 4,338,261 F47I probably benign Het
Nr1h3 G A 2: 91,191,857 T142I possibly damaging Het
Obox2 C T 7: 15,397,046 P68S probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Parn A G 16: 13,566,654 V515A probably benign Het
Ptdss2 T A 7: 141,147,092 F105I probably benign Het
Ruvbl1 A C 6: 88,465,552 T9P possibly damaging Het
Slc15a3 A G 19: 10,843,043 E8G probably benign Het
Slf1 G T 13: 77,103,583 Y303* probably null Het
Socs5 T C 17: 87,134,949 F439S probably damaging Het
Tcp10c C A 17: 13,370,211 A357E probably damaging Het
Tmem200c T C 17: 68,840,947 V175A probably damaging Het
Vmn2r124 T A 17: 18,049,597 H38Q possibly damaging Het
Vmn2r54 T G 7: 12,615,651 Q668P probably damaging Het
Xrcc2 T C 5: 25,705,710 S3G probably null Het
Other mutations in Capn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Capn11 APN 17 45643767 missense probably damaging 1.00
IGL01116:Capn11 APN 17 45638880 unclassified probably benign
IGL01121:Capn11 APN 17 45639132 missense probably benign 0.04
IGL01366:Capn11 APN 17 45653200 missense probably damaging 1.00
IGL01533:Capn11 APN 17 45632904 missense probably benign
IGL01595:Capn11 APN 17 45639434 missense probably benign 0.02
IGL02197:Capn11 APN 17 45639856 missense probably benign 0.14
IGL02683:Capn11 APN 17 45653591 missense probably damaging 1.00
IGL02696:Capn11 APN 17 45632709 missense probably damaging 1.00
IGL02711:Capn11 APN 17 45632415 missense probably damaging 1.00
IGL02900:Capn11 APN 17 45630614 splice site probably null
IGL03033:Capn11 APN 17 45642547 missense probably damaging 1.00
R0883:Capn11 UTSW 17 45638881 unclassified probably benign
R1494:Capn11 UTSW 17 45643809 missense probably damaging 1.00
R1735:Capn11 UTSW 17 45632401 nonsense probably null
R1785:Capn11 UTSW 17 45638697 missense probably benign 0.02
R1952:Capn11 UTSW 17 45642959 missense probably damaging 1.00
R2149:Capn11 UTSW 17 45633107 critical splice acceptor site probably null
R2495:Capn11 UTSW 17 45638763 missense probably damaging 0.97
R2516:Capn11 UTSW 17 45633799 missense probably damaging 0.98
R3934:Capn11 UTSW 17 45634287 splice site probably benign
R4016:Capn11 UTSW 17 45653756 missense probably damaging 1.00
R4226:Capn11 UTSW 17 45642466 critical splice donor site probably null
R4227:Capn11 UTSW 17 45642466 critical splice donor site probably null
R4774:Capn11 UTSW 17 45633080 missense probably benign 0.00
R4892:Capn11 UTSW 17 45633097 frame shift probably null
R5244:Capn11 UTSW 17 45633892 missense probably damaging 1.00
R5667:Capn11 UTSW 17 45639674 missense possibly damaging 0.87
R5671:Capn11 UTSW 17 45639674 missense possibly damaging 0.87
R5991:Capn11 UTSW 17 45659352 splice site probably null
R6180:Capn11 UTSW 17 45630766 missense probably damaging 1.00
R6193:Capn11 UTSW 17 45653504 critical splice donor site probably null
R6774:Capn11 UTSW 17 45657330 intron probably benign
R7047:Capn11 UTSW 17 45638696 nonsense probably null
R7302:Capn11 UTSW 17 45643812 missense probably damaging 1.00
R7516:Capn11 UTSW 17 45638840 missense possibly damaging 0.95
R7563:Capn11 UTSW 17 45633965 missense probably damaging 0.99
R7718:Capn11 UTSW 17 45643781 missense probably damaging 1.00
R7999:Capn11 UTSW 17 45639206 missense probably damaging 1.00
R8058:Capn11 UTSW 17 45643755 missense probably null 1.00
R8194:Capn11 UTSW 17 45633399 missense probably damaging 0.96
R8737:Capn11 UTSW 17 45632875 missense probably benign 0.01
R8989:Capn11 UTSW 17 45643857 missense probably damaging 1.00
R9037:Capn11 UTSW 17 45639431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCAAACCAGATGGCAGCAG -3'
(R):5'- GTTTAATCAGGGGCTGGCAC -3'

Sequencing Primer
(F):5'- CCAGATGGCAGCAGGGACAG -3'
(R):5'- GCACCCAAGCCTGGCTG -3'
Posted On2014-11-11