Incidental Mutation 'R2397:Mc2r'
ID248578
Institutional Source Beutler Lab
Gene Symbol Mc2r
Ensembl Gene ENSMUSG00000045569
Gene Namemelanocortin 2 receptor
Synonymsadrenocorticotropic hormone receptor, Acthr
MMRRC Submission 040364-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2397 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location68406907-68429251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68408153 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 23 (D23V)
Ref Sequence ENSEMBL: ENSMUSP00000058691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052347]
Predicted Effect probably benign
Transcript: ENSMUST00000052347
AA Change: D23V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058691
Gene: ENSMUSG00000045569
AA Change: D23V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 291 2.4e-13 PFAM
Pfam:7tm_1 41 276 1.1e-29 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MC2R encodes one member of the five-member G-protein associated melanocortin receptor family. Melanocortins (melanocyte-stimulating hormones and adrenocorticotropic hormone) are peptides derived from pro-opiomelanocortin (POMC). MC2R is selectively activated by adrenocorticotropic hormone, whereas the other four melanocortin receptors recognize a variety of melanocortin ligands. Mutations in MC2R can result in familial glucocorticoid deficiency. Alternate transcript variants have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality due to impaired gluconeogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 T A 8: 55,872,898 M174L probably benign Het
Adamtsl1 C T 4: 86,199,357 R186W probably damaging Het
Agtpbp1 C T 13: 59,474,569 V948I probably benign Het
Atp13a2 A G 4: 141,003,155 T787A probably benign Het
Capn11 T A 17: 45,653,221 N139I probably damaging Het
Cars T C 7: 143,592,507 D60G possibly damaging Het
Cers1 A T 8: 70,321,536 I148F probably benign Het
Col14a1 T C 15: 55,338,439 I41T unknown Het
Cyp2d26 C T 15: 82,794,035 G47R probably damaging Het
Dhx36 A T 3: 62,498,097 M205K probably benign Het
Dyrk2 T A 10: 118,861,368 probably benign Het
Echs1 T C 7: 140,112,477 H119R possibly damaging Het
Ehf T A 2: 103,276,819 D120V probably damaging Het
Esrra A G 19: 6,920,176 L71P probably damaging Het
Fam228a A T 12: 4,718,718 S200R probably benign Het
Fibcd1 A T 2: 31,834,423 M191K probably benign Het
Foxn4 A G 5: 114,255,495 L521P probably damaging Het
Fscn2 T C 11: 120,362,169 L154P probably damaging Het
Gm7964 T G 7: 83,757,113 noncoding transcript Het
Golga3 T C 5: 110,205,877 probably benign Het
Gria4 A G 9: 4,537,717 L197P probably damaging Het
Heg1 T A 16: 33,742,479 M913K probably damaging Het
Ifi205 T C 1: 174,017,575 T214A possibly damaging Het
Ift140 T G 17: 25,020,736 D122E probably damaging Het
Jakmip1 T A 5: 37,100,743 D244E probably damaging Het
Krt84 A G 15: 101,530,254 V266A probably benign Het
Ncr1 T A 7: 4,338,261 F47I probably benign Het
Nr1h3 G A 2: 91,191,857 T142I possibly damaging Het
Obox2 C T 7: 15,397,046 P68S probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Parn A G 16: 13,566,654 V515A probably benign Het
Ptdss2 T A 7: 141,147,092 F105I probably benign Het
Ruvbl1 A C 6: 88,465,552 T9P possibly damaging Het
Slc15a3 A G 19: 10,843,043 E8G probably benign Het
Slf1 G T 13: 77,103,583 Y303* probably null Het
Socs5 T C 17: 87,134,949 F439S probably damaging Het
Tcp10c C A 17: 13,370,211 A357E probably damaging Het
Tmem200c T C 17: 68,840,947 V175A probably damaging Het
Vmn2r124 T A 17: 18,049,597 H38Q possibly damaging Het
Vmn2r54 T G 7: 12,615,651 Q668P probably damaging Het
Xrcc2 T C 5: 25,705,710 S3G probably null Het
Other mutations in Mc2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Mc2r APN 18 68408072 missense probably benign 0.07
IGL01866:Mc2r APN 18 68407423 missense possibly damaging 0.81
IGL02002:Mc2r APN 18 68407434 missense probably benign 0.00
PIT4366001:Mc2r UTSW 18 68407755 missense probably benign
R0276:Mc2r UTSW 18 68408132 missense possibly damaging 0.69
R1061:Mc2r UTSW 18 68407809 missense probably damaging 1.00
R1085:Mc2r UTSW 18 68407346 missense probably benign
R1610:Mc2r UTSW 18 68407448 missense probably damaging 1.00
R1688:Mc2r UTSW 18 68408019 missense possibly damaging 0.68
R1930:Mc2r UTSW 18 68407782 missense probably benign 0.00
R2184:Mc2r UTSW 18 68408125 missense probably benign 0.02
R4913:Mc2r UTSW 18 68407340 missense probably benign
R5087:Mc2r UTSW 18 68408203 missense probably benign 0.01
R5506:Mc2r UTSW 18 68407948 nonsense probably null
R5781:Mc2r UTSW 18 68407395 missense possibly damaging 0.69
R5781:Mc2r UTSW 18 68407397 missense probably damaging 1.00
R6364:Mc2r UTSW 18 68407536 missense probably benign 0.00
R7908:Mc2r UTSW 18 68407965 missense probably benign 0.00
R7989:Mc2r UTSW 18 68407965 missense probably benign 0.00
Z1177:Mc2r UTSW 18 68407712 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CTTTCAAAACTGCCACGAGG -3'
(R):5'- ATGTGTTCTGTTTAACCTCAGATCC -3'

Sequencing Primer
(F):5'- CGAGGCTTAAGATAACCCATGTTTC -3'
(R):5'- GTTTAACCTCAGATCCTTCCACAC -3'
Posted On2014-11-11