Incidental Mutation 'R2398:Cse1l'
ID 248584
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1 like
Synonyms Cas, Xpo2, Capts, 2610100P18Rik
MMRRC Submission 040365-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2398 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 166747961-166788309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 166770917 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 369 (Y369C)
Ref Sequence ENSEMBL: ENSMUSP00000128376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably damaging
Transcript: ENSMUST00000002790
AA Change: Y369C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: Y369C

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135139
Predicted Effect probably damaging
Transcript: ENSMUST00000163437
AA Change: Y84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: Y84C

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166871
Predicted Effect probably damaging
Transcript: ENSMUST00000168599
AA Change: Y313C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: Y313C

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169290
AA Change: Y369C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718
AA Change: Y369C

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Meta Mutation Damage Score 0.9629 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,244,872 (GRCm39) D160G possibly damaging Het
Akr1c6 T C 13: 4,499,035 (GRCm39) S208P probably benign Het
Ap3b2 A G 7: 81,126,943 (GRCm39) F269S probably damaging Het
Ap3d1 G A 10: 80,555,006 (GRCm39) Q440* probably null Het
Cog2 T C 8: 125,256,665 (GRCm39) I137T probably benign Het
Dnah9 T C 11: 65,806,029 (GRCm39) N3357D probably damaging Het
Fam83b T C 9: 76,409,500 (GRCm39) T209A probably damaging Het
Gbp2 G A 3: 142,339,123 (GRCm39) A392T probably benign Het
Grsf1 G A 5: 88,821,695 (GRCm39) T123I probably damaging Het
Gzmc T A 14: 56,470,228 (GRCm39) I90F possibly damaging Het
Hook2 T A 8: 85,717,928 (GRCm39) N42K probably damaging Het
Hsp90aa1 T C 12: 110,658,755 (GRCm39) M629V possibly damaging Het
Ifna14 T C 4: 88,489,863 (GRCm39) D58G possibly damaging Het
Krtap4-8 T C 11: 99,671,103 (GRCm39) probably benign Het
Mocs1 T C 17: 49,759,862 (GRCm39) I381T probably damaging Het
Nbas A G 12: 13,482,946 (GRCm39) T1408A probably damaging Het
Or6c219 A G 10: 129,781,076 (GRCm39) F285S probably benign Het
Or8j3b T A 2: 86,205,183 (GRCm39) D191V probably damaging Het
Orc1 C T 4: 108,459,166 (GRCm39) T445I possibly damaging Het
Pdik1l T C 4: 134,005,710 (GRCm39) K411E probably benign Het
Pias3 A G 3: 96,611,129 (GRCm39) I443V probably benign Het
Psmd2 T C 16: 20,478,222 (GRCm39) S536P possibly damaging Het
Rnf10 C T 5: 115,385,332 (GRCm39) R554H probably benign Het
Smarcc2 C T 10: 128,305,551 (GRCm39) T325I possibly damaging Het
Smchd1 C A 17: 71,667,136 (GRCm39) C1752F probably damaging Het
Smchd1 G A 17: 71,733,431 (GRCm39) probably benign Het
Svil A G 18: 5,060,613 (GRCm39) probably null Het
Tex52 T C 6: 128,356,540 (GRCm39) S78P probably damaging Het
Tmem63c T G 12: 87,103,307 (GRCm39) V27G probably damaging Het
Ttc41 A G 10: 86,549,250 (GRCm39) N148S possibly damaging Het
Vmn2r67 T C 7: 84,785,921 (GRCm39) I695V probably damaging Het
Wipf2 T A 11: 98,789,543 (GRCm39) probably null Het
Zc3h18 A G 8: 123,140,605 (GRCm39) probably benign Het
Zfp804a T A 2: 82,089,013 (GRCm39) N947K possibly damaging Het
Zfyve26 T C 12: 79,329,573 (GRCm39) probably null Het
Zic2 G T 14: 122,716,329 (GRCm39) E422* probably null Het
Zmym4 A T 4: 126,816,929 (GRCm39) D4E probably damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166,769,724 (GRCm39) missense probably damaging 1.00
IGL01306:Cse1l APN 2 166,769,428 (GRCm39) nonsense probably null
IGL01672:Cse1l APN 2 166,771,887 (GRCm39) missense probably damaging 1.00
IGL02060:Cse1l APN 2 166,772,573 (GRCm39) missense probably damaging 1.00
IGL02897:Cse1l APN 2 166,761,628 (GRCm39) missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166,784,977 (GRCm39) splice site probably benign
ANU23:Cse1l UTSW 2 166,769,428 (GRCm39) nonsense probably null
PIT4585001:Cse1l UTSW 2 166,783,394 (GRCm39) missense probably damaging 1.00
R0195:Cse1l UTSW 2 166,782,008 (GRCm39) missense probably benign
R1114:Cse1l UTSW 2 166,783,123 (GRCm39) splice site probably benign
R1539:Cse1l UTSW 2 166,768,292 (GRCm39) missense probably benign 0.00
R1721:Cse1l UTSW 2 166,768,331 (GRCm39) missense probably damaging 1.00
R1779:Cse1l UTSW 2 166,782,044 (GRCm39) splice site probably null
R1913:Cse1l UTSW 2 166,764,111 (GRCm39) missense probably damaging 1.00
R2069:Cse1l UTSW 2 166,783,412 (GRCm39) missense probably benign 0.01
R4110:Cse1l UTSW 2 166,783,970 (GRCm39) missense probably benign 0.00
R4195:Cse1l UTSW 2 166,771,899 (GRCm39) missense probably damaging 1.00
R4603:Cse1l UTSW 2 166,786,452 (GRCm39) missense probably benign 0.09
R4686:Cse1l UTSW 2 166,774,080 (GRCm39) missense probably damaging 1.00
R4867:Cse1l UTSW 2 166,768,323 (GRCm39) missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166,771,714 (GRCm39) missense probably damaging 1.00
R5164:Cse1l UTSW 2 166,786,348 (GRCm39) missense probably benign 0.02
R5475:Cse1l UTSW 2 166,783,174 (GRCm39) missense probably damaging 1.00
R5493:Cse1l UTSW 2 166,783,110 (GRCm39) intron probably benign
R5782:Cse1l UTSW 2 166,770,921 (GRCm39) missense probably damaging 1.00
R5862:Cse1l UTSW 2 166,757,127 (GRCm39) missense probably benign 0.00
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6913:Cse1l UTSW 2 166,771,797 (GRCm39) missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166,764,708 (GRCm39) missense probably benign
R7871:Cse1l UTSW 2 166,777,591 (GRCm39) splice site probably null
R8001:Cse1l UTSW 2 166,781,833 (GRCm39) missense probably damaging 1.00
R8057:Cse1l UTSW 2 166,781,845 (GRCm39) missense probably damaging 1.00
R8175:Cse1l UTSW 2 166,785,128 (GRCm39) critical splice donor site probably null
R8347:Cse1l UTSW 2 166,769,505 (GRCm39) missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166,761,604 (GRCm39) missense probably benign 0.00
R8479:Cse1l UTSW 2 166,763,893 (GRCm39) missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166,785,000 (GRCm39) missense probably damaging 1.00
R9206:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9208:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9522:Cse1l UTSW 2 166,776,673 (GRCm39) missense probably benign
R9599:Cse1l UTSW 2 166,783,386 (GRCm39) missense probably benign
R9600:Cse1l UTSW 2 166,757,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTTACTGCTGCAGTCACAG -3'
(R):5'- GCCAGAAGTCAATGTGAGCATC -3'

Sequencing Primer
(F):5'- CTTTACTGCTGCAGTCACAGTGAAAG -3'
(R):5'- TGTGAGGGGTCTAACCGAC -3'
Posted On 2014-11-11