Mutagenetix > Incidental Mutation

Incidental Mutation 'R2398:Cse1l'

248584

Institutional Source

Beutler Lab

Gene Symbol

Cse1l

Ensembl Gene

ENSMUSG00000002718

Gene Name

chromosome segregation 1-like (S. cerevisiae)

Synonyms

Capts, Xpo2, 2610100P18Rik, Cas

MMRRC Submission

040365-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

166906040-166946389 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 166928997 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 369 (Y369C)

Ref Sequence

ENSEMBL: ENSMUSP00000128376 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]

AlphaFold

Q9ERK4

Predicted Effect

probably damaging
Transcript: ENSMUST00000002790
AA Change: Y369C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: Y369C

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	526	9.2e-169	PFAM
Pfam:CAS_CSE1	527	962	1.1e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132402

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135139

Predicted Effect

probably damaging
Transcript: ENSMUST00000163437
AA Change: Y84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: Y84C

Domain	Start	End	E-Value	Type
Pfam:Cse1	1	237	7.9e-105	PFAM
Pfam:CAS_CSE1	225	649	2.3e-195	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166871

Predicted Effect

probably damaging
Transcript: ENSMUST00000168599
AA Change: Y313C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: Y313C

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	256	8.6e-40	PFAM
Pfam:Cse1	255	470	7.3e-99	PFAM
Pfam:CAS_CSE1	471	906	1.3e-201	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000169290
AA Change: Y369C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718
AA Change: Y369C

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	389	5.2e-102	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171410

Meta Mutation Damage Score

0.9629

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	C	2: 35,354,860	D160G	possibly damaging	Het
Akr1c6	T	C	13: 4,449,036	S208P	probably benign	Het
Ap3b2	A	G	7: 81,477,195	F269S	probably damaging	Het
Ap3d1	G	A	10: 80,719,172	Q440*	probably null	Het
Cog2	T	C	8: 124,529,926	I137T	probably benign	Het
Dnah9	T	C	11: 65,915,203	N3357D	probably damaging	Het
Fam83b	T	C	9: 76,502,218	T209A	probably damaging	Het
Gbp2	G	A	3: 142,633,362	A392T	probably benign	Het
Grsf1	G	A	5: 88,673,836	T123I	probably damaging	Het
Gzmc	T	A	14: 56,232,771	I90F	possibly damaging	Het
Hook2	T	A	8: 84,991,299	N42K	probably damaging	Het
Hsp90aa1	T	C	12: 110,692,321	M629V	possibly damaging	Het
Ifna14	T	C	4: 88,571,626	D58G	possibly damaging	Het
Krtap4-8	T	C	11: 99,780,277		probably benign	Het
Mocs1	T	C	17: 49,452,834	I381T	probably damaging	Het
Nbas	A	G	12: 13,432,945	T1408A	probably damaging	Het
Olfr1057	T	A	2: 86,374,839	D191V	probably damaging	Het
Olfr818	A	G	10: 129,945,207	F285S	probably benign	Het
Orc1	C	T	4: 108,601,969	T445I	possibly damaging	Het
Pdik1l	T	C	4: 134,278,399	K411E	probably benign	Het
Pias3	A	G	3: 96,703,813	I443V	probably benign	Het
Psmd2	T	C	16: 20,659,472	S536P	possibly damaging	Het
Rnf10	C	T	5: 115,247,273	R554H	probably benign	Het
Smarcc2	C	T	10: 128,469,682	T325I	possibly damaging	Het
Smchd1	C	A	17: 71,360,141	C1752F	probably damaging	Het
Smchd1	G	A	17: 71,426,436		probably benign	Het
Svil	A	G	18: 5,060,613		probably null	Het
Tex52	T	C	6: 128,379,577	S78P	probably damaging	Het
Tmem63c	T	G	12: 87,056,533	V27G	probably damaging	Het
Ttc41	A	G	10: 86,713,386	N148S	possibly damaging	Het
Vmn2r67	T	C	7: 85,136,713	I695V	probably damaging	Het
Wipf2	T	A	11: 98,898,717		probably null	Het
Zc3h18	A	G	8: 122,413,866		probably benign	Het
Zfp804a	T	A	2: 82,258,669	N947K	possibly damaging	Het
Zfyve26	T	C	12: 79,282,799		probably null	Het
Zic2	G	T	14: 122,478,917	E422*	probably null	Het
Zmym4	A	T	4: 126,923,136	D4E	probably damaging	Het

Other mutations in Cse1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Cse1l	APN	2	166927804	missense	probably damaging	1.00
IGL01306:Cse1l	APN	2	166927508	nonsense	probably null
IGL01672:Cse1l	APN	2	166929967	missense	probably damaging	1.00
IGL02060:Cse1l	APN	2	166930653	missense	probably damaging	1.00
IGL02897:Cse1l	APN	2	166919708	missense	possibly damaging	0.47
IGL03375:Cse1l	APN	2	166943057	splice site	probably benign
ANU23:Cse1l	UTSW	2	166927508	nonsense	probably null
PIT4585001:Cse1l	UTSW	2	166941474	missense	probably damaging	1.00
R0195:Cse1l	UTSW	2	166940088	missense	probably benign
R1114:Cse1l	UTSW	2	166941203	splice site	probably benign
R1539:Cse1l	UTSW	2	166926372	missense	probably benign	0.00
R1721:Cse1l	UTSW	2	166926411	missense	probably damaging	1.00
R1779:Cse1l	UTSW	2	166940124	splice site	probably null
R1913:Cse1l	UTSW	2	166922191	missense	probably damaging	1.00
R2069:Cse1l	UTSW	2	166941492	missense	probably benign	0.01
R4110:Cse1l	UTSW	2	166942050	missense	probably benign	0.00
R4195:Cse1l	UTSW	2	166929979	missense	probably damaging	1.00
R4603:Cse1l	UTSW	2	166944532	missense	probably benign	0.09
R4686:Cse1l	UTSW	2	166932160	missense	probably damaging	1.00
R4867:Cse1l	UTSW	2	166926403	missense	possibly damaging	0.76
R4942:Cse1l	UTSW	2	166929794	missense	probably damaging	1.00
R5164:Cse1l	UTSW	2	166944428	missense	probably benign	0.02
R5475:Cse1l	UTSW	2	166941254	missense	probably damaging	1.00
R5493:Cse1l	UTSW	2	166941190	intron	probably benign
R5782:Cse1l	UTSW	2	166929001	missense	probably damaging	1.00
R5862:Cse1l	UTSW	2	166915207	missense	probably benign	0.00
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6913:Cse1l	UTSW	2	166929877	missense	possibly damaging	0.65
R7683:Cse1l	UTSW	2	166922788	missense	probably benign
R7871:Cse1l	UTSW	2	166935671	splice site	probably null
R8001:Cse1l	UTSW	2	166939913	missense	probably damaging	1.00
R8057:Cse1l	UTSW	2	166939925	missense	probably damaging	1.00
R8175:Cse1l	UTSW	2	166943208	critical splice donor site	probably null
R8347:Cse1l	UTSW	2	166927585	missense	possibly damaging	0.95
R8386:Cse1l	UTSW	2	166919684	missense	probably benign	0.00
R8479:Cse1l	UTSW	2	166921973	missense	possibly damaging	0.95
R8973:Cse1l	UTSW	2	166943080	missense	probably damaging	1.00
R9206:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9208:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9522:Cse1l	UTSW	2	166934753	missense	probably benign
R9599:Cse1l	UTSW	2	166941466	missense	probably benign
R9600:Cse1l	UTSW	2	166915199	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTTTACTGCTGCAGTCACAG -3'
(R):5'- GCCAGAAGTCAATGTGAGCATC -3'

Sequencing Primer
(F):5'- CTTTACTGCTGCAGTCACAGTGAAAG -3'
(R):5'- TGTGAGGGGTCTAACCGAC -3'

Posted On

2014-11-11