Incidental Mutation 'R2398:Ifna14'
ID248588
Institutional Source Beutler Lab
Gene Symbol Ifna14
Ensembl Gene ENSMUSG00000095896
Gene Nameinterferon alpha 14
SynonymsOTTMUSG00000007662
MMRRC Submission 040365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2398 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88571229-88571798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88571626 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 58 (D58G)
Ref Sequence ENSEMBL: ENSMUSP00000099872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102808]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102808
AA Change: D58G

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099872
Gene: ENSMUSG00000095896
AA Change: D58G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IFabd 58 175 2.41e-68 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,860 D160G possibly damaging Het
Akr1c6 T C 13: 4,449,036 S208P probably benign Het
Ap3b2 A G 7: 81,477,195 F269S probably damaging Het
Ap3d1 G A 10: 80,719,172 Q440* probably null Het
Cog2 T C 8: 124,529,926 I137T probably benign Het
Cse1l A G 2: 166,928,997 Y369C probably damaging Het
Dnah9 T C 11: 65,915,203 N3357D probably damaging Het
Fam83b T C 9: 76,502,218 T209A probably damaging Het
Gbp2 G A 3: 142,633,362 A392T probably benign Het
Grsf1 G A 5: 88,673,836 T123I probably damaging Het
Gzmc T A 14: 56,232,771 I90F possibly damaging Het
Hook2 T A 8: 84,991,299 N42K probably damaging Het
Hsp90aa1 T C 12: 110,692,321 M629V possibly damaging Het
Krtap4-8 T C 11: 99,780,277 probably benign Het
Mocs1 T C 17: 49,452,834 I381T probably damaging Het
Nbas A G 12: 13,432,945 T1408A probably damaging Het
Olfr1057 T A 2: 86,374,839 D191V probably damaging Het
Olfr818 A G 10: 129,945,207 F285S probably benign Het
Orc1 C T 4: 108,601,969 T445I possibly damaging Het
Pdik1l T C 4: 134,278,399 K411E probably benign Het
Pias3 A G 3: 96,703,813 I443V probably benign Het
Psmd2 T C 16: 20,659,472 S536P possibly damaging Het
Rnf10 C T 5: 115,247,273 R554H probably benign Het
Smarcc2 C T 10: 128,469,682 T325I possibly damaging Het
Smchd1 C A 17: 71,360,141 C1752F probably damaging Het
Smchd1 G A 17: 71,426,436 probably benign Het
Svil A G 18: 5,060,613 probably null Het
Tex52 T C 6: 128,379,577 S78P probably damaging Het
Tmem63c T G 12: 87,056,533 V27G probably damaging Het
Ttc41 A G 10: 86,713,386 N148S possibly damaging Het
Vmn2r67 T C 7: 85,136,713 I695V probably damaging Het
Wipf2 T A 11: 98,898,717 probably null Het
Zc3h18 A G 8: 122,413,866 probably benign Het
Zfp804a T A 2: 82,258,669 N947K possibly damaging Het
Zfyve26 T C 12: 79,282,799 probably null Het
Zic2 G T 14: 122,478,917 E422* probably null Het
Zmym4 A T 4: 126,923,136 D4E probably damaging Het
Other mutations in Ifna14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02827:Ifna14 APN 4 88571364 missense probably benign 0.02
R4578:Ifna14 UTSW 4 88571510 missense possibly damaging 0.81
R4666:Ifna14 UTSW 4 88571336 missense probably benign 0.01
R5163:Ifna14 UTSW 4 88571362 missense probably damaging 1.00
R5199:Ifna14 UTSW 4 88571362 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACCTGCTGCATCAGACAG -3'
(R):5'- CATCTGCAAGATCCACAATGGC -3'

Sequencing Primer
(F):5'- ACAGCCTTGCAGGTCATTGAG -3'
(R):5'- AGATCCACAATGGCTAGGCTCTG -3'
Posted On2014-11-11