Incidental Mutation 'R2398:Orc1'
ID248589
Institutional Source Beutler Lab
Gene Symbol Orc1
Ensembl Gene ENSMUSG00000028587
Gene Nameorigin recognition complex, subunit 1
SynonymsMmORC1, Orc1l
MMRRC Submission 040365-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2398 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108579423-108614833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108601969 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 445 (T445I)
Ref Sequence ENSEMBL: ENSMUSP00000099805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102744]
PDB Structure
Structure of free mouse ORC1 BAH domain [X-RAY DIFFRACTION]
Structure of mouse ORC1 BAH domain bound to H4K20me2 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102744
AA Change: T445I

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099805
Gene: ENSMUSG00000028587
AA Change: T445I

DomainStartEndE-ValueType
BAH 44 170 1.88e-31 SMART
low complexity region 394 417 N/A INTRINSIC
AAA 505 656 1e-7 SMART
Cdc6_C 757 837 5.45e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129931
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is the largest subunit of the ORC complex. While other ORC subunits are stable throughout the cell cycle, the levels of this protein vary during the cell cycle, which has been shown to be controlled by ubiquitin-mediated proteolysis after initiation of DNA replication. This protein is found to be selectively phosphorylated during mitosis. It is also reported to interact with MYST histone acetyltransferase 2 (MyST2/HBO1), a protein involved in control of transcription silencing. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T C 2: 35,354,860 D160G possibly damaging Het
Akr1c6 T C 13: 4,449,036 S208P probably benign Het
Ap3b2 A G 7: 81,477,195 F269S probably damaging Het
Ap3d1 G A 10: 80,719,172 Q440* probably null Het
Cog2 T C 8: 124,529,926 I137T probably benign Het
Cse1l A G 2: 166,928,997 Y369C probably damaging Het
Dnah9 T C 11: 65,915,203 N3357D probably damaging Het
Fam83b T C 9: 76,502,218 T209A probably damaging Het
Gbp2 G A 3: 142,633,362 A392T probably benign Het
Grsf1 G A 5: 88,673,836 T123I probably damaging Het
Gzmc T A 14: 56,232,771 I90F possibly damaging Het
Hook2 T A 8: 84,991,299 N42K probably damaging Het
Hsp90aa1 T C 12: 110,692,321 M629V possibly damaging Het
Ifna14 T C 4: 88,571,626 D58G possibly damaging Het
Krtap4-8 T C 11: 99,780,277 probably benign Het
Mocs1 T C 17: 49,452,834 I381T probably damaging Het
Nbas A G 12: 13,432,945 T1408A probably damaging Het
Olfr1057 T A 2: 86,374,839 D191V probably damaging Het
Olfr818 A G 10: 129,945,207 F285S probably benign Het
Pdik1l T C 4: 134,278,399 K411E probably benign Het
Pias3 A G 3: 96,703,813 I443V probably benign Het
Psmd2 T C 16: 20,659,472 S536P possibly damaging Het
Rnf10 C T 5: 115,247,273 R554H probably benign Het
Smarcc2 C T 10: 128,469,682 T325I possibly damaging Het
Smchd1 C A 17: 71,360,141 C1752F probably damaging Het
Smchd1 G A 17: 71,426,436 probably benign Het
Svil A G 18: 5,060,613 probably null Het
Tex52 T C 6: 128,379,577 S78P probably damaging Het
Tmem63c T G 12: 87,056,533 V27G probably damaging Het
Ttc41 A G 10: 86,713,386 N148S possibly damaging Het
Vmn2r67 T C 7: 85,136,713 I695V probably damaging Het
Wipf2 T A 11: 98,898,717 probably null Het
Zc3h18 A G 8: 122,413,866 probably benign Het
Zfp804a T A 2: 82,258,669 N947K possibly damaging Het
Zfyve26 T C 12: 79,282,799 probably null Het
Zic2 G T 14: 122,478,917 E422* probably null Het
Zmym4 A T 4: 126,923,136 D4E probably damaging Het
Other mutations in Orc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Orc1 APN 4 108595325 splice site probably benign
IGL00709:Orc1 APN 4 108590778 critical splice donor site probably null
IGL01124:Orc1 APN 4 108588787 splice site probably benign
IGL01514:Orc1 APN 4 108602052 missense probably damaging 0.97
IGL01677:Orc1 APN 4 108604585 missense probably damaging 1.00
IGL01782:Orc1 APN 4 108606268 missense possibly damaging 0.78
IGL01886:Orc1 APN 4 108603957 splice site probably null
IGL01912:Orc1 APN 4 108590744 missense probably damaging 1.00
IGL02057:Orc1 APN 4 108588729 missense possibly damaging 0.53
IGL02155:Orc1 APN 4 108590677 missense probably benign 0.00
IGL02311:Orc1 APN 4 108599974 missense probably benign
IGL02616:Orc1 APN 4 108595479 missense probably benign 0.00
land_lubber UTSW 4 108588687 start codon destroyed probably damaging 0.99
R0012:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0195:Orc1 UTSW 4 108614308 nonsense probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0239:Orc1 UTSW 4 108595646 critical splice donor site probably null
R0611:Orc1 UTSW 4 108602032 missense probably benign
R1351:Orc1 UTSW 4 108595367 missense probably benign 0.01
R1966:Orc1 UTSW 4 108612217 missense probably damaging 1.00
R2018:Orc1 UTSW 4 108590700 missense possibly damaging 0.95
R3110:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3112:Orc1 UTSW 4 108604560 missense probably benign 0.01
R3712:Orc1 UTSW 4 108604021 missense probably damaging 1.00
R3716:Orc1 UTSW 4 108614459 missense probably damaging 1.00
R3829:Orc1 UTSW 4 108605631 missense probably damaging 1.00
R4282:Orc1 UTSW 4 108606274 missense probably benign 0.18
R4320:Orc1 UTSW 4 108588776 missense probably benign
R4321:Orc1 UTSW 4 108588776 missense probably benign
R4322:Orc1 UTSW 4 108588776 missense probably benign
R4348:Orc1 UTSW 4 108593452 missense probably damaging 0.98
R4562:Orc1 UTSW 4 108602055 critical splice donor site probably null
R4772:Orc1 UTSW 4 108579568 utr 5 prime probably benign
R4914:Orc1 UTSW 4 108604558 missense probably damaging 1.00
R4964:Orc1 UTSW 4 108614473 makesense probably null
R5219:Orc1 UTSW 4 108590769 missense probably damaging 1.00
R5428:Orc1 UTSW 4 108599940 missense probably benign 0.00
R5655:Orc1 UTSW 4 108593439 missense probably benign 0.09
R5693:Orc1 UTSW 4 108613079 missense probably benign 0.01
R5936:Orc1 UTSW 4 108601983 missense probably benign 0.10
R5960:Orc1 UTSW 4 108606298 missense possibly damaging 0.67
R6294:Orc1 UTSW 4 108590670 missense probably benign 0.01
R6504:Orc1 UTSW 4 108590717 missense probably benign 0.15
R6533:Orc1 UTSW 4 108597447 missense probably benign 0.05
R6775:Orc1 UTSW 4 108603455 missense probably damaging 1.00
R7123:Orc1 UTSW 4 108588687 start codon destroyed probably damaging 0.99
R7156:Orc1 UTSW 4 108595459 missense probably benign 0.00
R7327:Orc1 UTSW 4 108588714 missense probably benign 0.01
R7552:Orc1 UTSW 4 108588754 missense probably benign 0.41
R7842:Orc1 UTSW 4 108605547 missense probably benign 0.00
R7925:Orc1 UTSW 4 108605547 missense probably benign 0.00
R7982:Orc1 UTSW 4 108603371 intron probably null
R8033:Orc1 UTSW 4 108605564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGGGATCATGTTTGGACTG -3'
(R):5'- ACTCTTTCCTCATGAGAAAGCTTTC -3'

Sequencing Primer
(F):5'- ACTGTGAACATGTTTGATGTGAGC -3'
(R):5'- GTGACATAATAGTGCTGGCTCAACC -3'
Posted On2014-11-11