Incidental Mutation 'R0302:Zfr2'
ID 24859
Institutional Source Beutler Lab
Gene Symbol Zfr2
Ensembl Gene ENSMUSG00000034949
Gene Name zinc finger RNA binding protein 2
Synonyms 9130206N08Rik, 2010013I23Rik
MMRRC Submission 038514-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R0302 (G1)
Quality Score 205
Status Validated
Chromosome 10
Chromosomal Location 81233155-81252123 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 81251336 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117798] [ENSMUST00000119547]
AlphaFold E9Q5M4
Predicted Effect unknown
Transcript: ENSMUST00000117798
AA Change: G843W
SMART Domains Protein: ENSMUSP00000113913
Gene: ENSMUSG00000034949
AA Change: G843W

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
low complexity region 44 62 N/A INTRINSIC
low complexity region 123 163 N/A INTRINSIC
ZnF_U1 202 236 3.58e-5 SMART
ZnF_C2H2 205 229 7.68e0 SMART
ZnF_U1 249 283 3.78e-4 SMART
ZnF_C2H2 252 276 4.12e0 SMART
ZnF_U1 397 431 3.78e-4 SMART
ZnF_C2H2 400 424 1.99e0 SMART
low complexity region 484 508 N/A INTRINSIC
DZF 585 837 2.06e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119547
SMART Domains Protein: ENSMUSP00000113576
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132174
Predicted Effect unknown
Transcript: ENSMUST00000137999
AA Change: R167L
SMART Domains Protein: ENSMUSP00000120853
Gene: ENSMUSG00000034949
AA Change: R167L

DomainStartEndE-ValueType
Pfam:DZF 2 162 1.3e-32 PFAM
low complexity region 166 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148029
Meta Mutation Damage Score 0.1908 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 T C 4: 126,317,392 E244G probably benign Het
Aldh1l2 G A 10: 83,520,365 P54S probably damaging Het
Ankdd1a G A 9: 65,509,642 probably benign Het
Ankra2 T A 13: 98,271,692 S216R probably damaging Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Cacna1s A G 1: 136,100,604 Y893C probably benign Het
Capza2 G A 6: 17,648,524 R15H probably benign Het
Cbfa2t2 T C 2: 154,534,876 probably benign Het
Ccdc96 A T 5: 36,486,101 T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,700,299 probably null Het
Ccl4 T A 11: 83,663,454 probably benign Het
Cpt1b A G 15: 89,417,870 Y702H probably benign Het
Cr1l G A 1: 195,117,793 T153I probably damaging Het
Cyth2 C A 7: 45,810,585 E57* probably null Het
Daxx T A 17: 33,913,620 S575T probably damaging Het
Depdc5 T C 5: 32,904,546 probably benign Het
Dnah12 A G 14: 26,799,999 D1923G probably damaging Het
Dnah7b A G 1: 46,123,777 T428A probably benign Het
Dnm2 G T 9: 21,500,343 A619S probably benign Het
Enpp2 T C 15: 54,860,061 T639A probably benign Het
Epsti1 A T 14: 77,939,926 H182L probably damaging Het
Exoc3l C T 8: 105,293,543 R250Q probably benign Het
Ggn G T 7: 29,171,240 probably null Het
Il1rap A G 16: 26,692,794 N196S probably benign Het
Ints6 T C 14: 62,709,512 T335A probably damaging Het
Itga1 G A 13: 115,012,318 probably benign Het
Kifc3 G T 8: 95,103,470 Q557K possibly damaging Het
Krt23 A G 11: 99,478,201 I422T probably benign Het
Lcn2 A G 2: 32,384,889 probably benign Het
Lonp2 A G 8: 86,637,991 T326A possibly damaging Het
Lrpprc T C 17: 84,740,078 I909V possibly damaging Het
Lrrc14 G T 15: 76,714,352 R396L probably benign Het
Lypd6 T G 2: 50,165,667 probably benign Het
Man2b1 A G 8: 85,093,016 N610S probably damaging Het
Map2 A T 1: 66,414,828 N959I probably benign Het
Mctp2 C T 7: 72,090,264 V793I possibly damaging Het
Med25 A C 7: 44,880,558 probably benign Het
Mfsd6 T C 1: 52,709,457 Y83C probably damaging Het
Mtbp A T 15: 55,625,424 M499L probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Nfat5 T C 8: 107,358,701 I542T probably damaging Het
Nr1h3 A G 2: 91,192,013 M90T probably damaging Het
Nsmce4a A G 7: 130,545,893 probably benign Het
Olfr1168 T A 2: 88,185,510 I211N possibly damaging Het
Oprl1 G A 2: 181,719,228 C318Y probably benign Het
Pbx3 A T 2: 34,224,560 S46T probably benign Het
Pign A T 1: 105,589,093 F575I possibly damaging Het
Ptpn13 G T 5: 103,565,225 S1738I probably benign Het
Rnf126 G T 10: 79,759,223 P269Q probably damaging Het
Ryr3 G A 2: 112,647,123 probably benign Het
Slc2a7 C T 4: 150,149,521 A31V probably damaging Het
Slc6a12 A G 6: 121,363,259 D487G probably damaging Het
Son G T 16: 91,656,144 G593V probably damaging Het
Spata31d1a T C 13: 59,703,150 N388S probably benign Het
Spg11 A T 2: 122,092,187 M927K possibly damaging Het
Taf13 A G 3: 108,571,722 M1V probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trio A G 15: 27,902,517 F286S probably damaging Het
Trpm2 A C 10: 77,943,990 probably benign Het
Ttc7b T C 12: 100,387,179 M390V possibly damaging Het
Vmn1r184 A T 7: 26,267,543 Q238L probably damaging Het
Zfp236 T C 18: 82,658,088 E368G probably damaging Het
Other mutations in Zfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfr2 APN 10 81242085 missense probably damaging 0.96
IGL01622:Zfr2 APN 10 81251359 missense probably benign
IGL01623:Zfr2 APN 10 81251359 missense probably benign
IGL02719:Zfr2 APN 10 81244712 missense probably damaging 1.00
IGL03036:Zfr2 APN 10 81242151 missense probably benign 0.01
R0837:Zfr2 UTSW 10 81245408 missense probably damaging 1.00
R1557:Zfr2 UTSW 10 81247391 missense probably benign 0.01
R1714:Zfr2 UTSW 10 81244749 missense probably damaging 1.00
R1737:Zfr2 UTSW 10 81242085 missense probably damaging 0.96
R1991:Zfr2 UTSW 10 81242852 missense possibly damaging 0.86
R2134:Zfr2 UTSW 10 81242901 missense probably damaging 1.00
R2148:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R2150:Zfr2 UTSW 10 81242116 missense probably benign 0.13
R3703:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3704:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3705:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R3715:Zfr2 UTSW 10 81246079 missense probably benign 0.40
R4301:Zfr2 UTSW 10 81242184 unclassified probably benign
R4654:Zfr2 UTSW 10 81251249 splice site probably null
R4811:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R5290:Zfr2 UTSW 10 81246710 frame shift probably null
R5781:Zfr2 UTSW 10 81243713 missense probably benign 0.07
R7114:Zfr2 UTSW 10 81244725 missense probably damaging 1.00
R8192:Zfr2 UTSW 10 81242815 missense possibly damaging 0.83
R8359:Zfr2 UTSW 10 81242819 missense possibly damaging 0.57
R8389:Zfr2 UTSW 10 81245489 missense probably benign
R8827:Zfr2 UTSW 10 81242785 missense probably benign 0.00
R8953:Zfr2 UTSW 10 81248437 missense probably damaging 0.99
R9086:Zfr2 UTSW 10 81240195 missense probably damaging 0.96
R9189:Zfr2 UTSW 10 81244662 missense probably damaging 1.00
R9487:Zfr2 UTSW 10 81240135 missense probably benign 0.33
R9592:Zfr2 UTSW 10 81233746 missense unknown
R9645:Zfr2 UTSW 10 81248418 nonsense probably null
X0063:Zfr2 UTSW 10 81242957 critical splice donor site probably null
Z1177:Zfr2 UTSW 10 81246084 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGTTCCTCTACCCAGGAAGTACAG -3'
(R):5'- GAGGAGGCAATTCAGATCCCATTCAC -3'

Sequencing Primer
(F):5'- AGCTGGTGGTGACATTCCC -3'
(R):5'- CCAAGGAGATCACTGCTATCTGG -3'
Posted On 2013-04-16