Incidental Mutation 'R0302:Zfr2'
ID 24859
Institutional Source Beutler Lab
Gene Symbol Zfr2
Ensembl Gene ENSMUSG00000034949
Gene Name zinc finger RNA binding protein 2
Synonyms 2010013I23Rik, 9130206N08Rik
MMRRC Submission 038514-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R0302 (G1)
Quality Score 205
Status Validated
Chromosome 10
Chromosomal Location 81068989-81087957 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 81087170 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117798] [ENSMUST00000119547]
AlphaFold E9Q5M4
Predicted Effect unknown
Transcript: ENSMUST00000117798
AA Change: G843W
SMART Domains Protein: ENSMUSP00000113913
Gene: ENSMUSG00000034949
AA Change: G843W

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
low complexity region 44 62 N/A INTRINSIC
low complexity region 123 163 N/A INTRINSIC
ZnF_U1 202 236 3.58e-5 SMART
ZnF_C2H2 205 229 7.68e0 SMART
ZnF_U1 249 283 3.78e-4 SMART
ZnF_C2H2 252 276 4.12e0 SMART
ZnF_U1 397 431 3.78e-4 SMART
ZnF_C2H2 400 424 1.99e0 SMART
low complexity region 484 508 N/A INTRINSIC
DZF 585 837 2.06e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119547
SMART Domains Protein: ENSMUSP00000113576
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132174
Predicted Effect unknown
Transcript: ENSMUST00000137999
AA Change: R167L
SMART Domains Protein: ENSMUSP00000120853
Gene: ENSMUSG00000034949
AA Change: R167L

DomainStartEndE-ValueType
Pfam:DZF 2 162 1.3e-32 PFAM
low complexity region 166 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148029
Meta Mutation Damage Score 0.1908 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprs T C 4: 126,211,185 (GRCm39) E244G probably benign Het
Aldh1l2 G A 10: 83,356,229 (GRCm39) P54S probably damaging Het
Ankdd1a G A 9: 65,416,924 (GRCm39) probably benign Het
Ankra2 T A 13: 98,408,200 (GRCm39) S216R probably damaging Het
Asah2 A T 19: 32,030,356 (GRCm39) N105K probably benign Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Cacna1s A G 1: 136,028,342 (GRCm39) Y893C probably benign Het
Capza2 G A 6: 17,648,523 (GRCm39) R15H probably benign Het
Cbfa2t2 T C 2: 154,376,796 (GRCm39) probably benign Het
Ccdc96 A T 5: 36,643,445 (GRCm39) T484S possibly damaging Het
Cckar GCTTAGCCTCTTCT GCT 5: 53,857,641 (GRCm39) probably null Het
Ccl4 T A 11: 83,554,280 (GRCm39) probably benign Het
Cpt1b A G 15: 89,302,073 (GRCm39) Y702H probably benign Het
Cr1l G A 1: 194,800,101 (GRCm39) T153I probably damaging Het
Cyth2 C A 7: 45,460,009 (GRCm39) E57* probably null Het
Daxx T A 17: 34,132,594 (GRCm39) S575T probably damaging Het
Depdc5 T C 5: 33,061,890 (GRCm39) probably benign Het
Dnah12 A G 14: 26,521,956 (GRCm39) D1923G probably damaging Het
Dnah7b A G 1: 46,162,937 (GRCm39) T428A probably benign Het
Dnm2 G T 9: 21,411,639 (GRCm39) A619S probably benign Het
Enpp2 T C 15: 54,723,457 (GRCm39) T639A probably benign Het
Epsti1 A T 14: 78,177,366 (GRCm39) H182L probably damaging Het
Exoc3l C T 8: 106,020,175 (GRCm39) R250Q probably benign Het
Ggn G T 7: 28,870,665 (GRCm39) probably null Het
Il1rap A G 16: 26,511,544 (GRCm39) N196S probably benign Het
Ints6 T C 14: 62,946,961 (GRCm39) T335A probably damaging Het
Itga1 G A 13: 115,148,854 (GRCm39) probably benign Het
Kifc3 G T 8: 95,830,098 (GRCm39) Q557K possibly damaging Het
Krt23 A G 11: 99,369,027 (GRCm39) I422T probably benign Het
Lcn2 A G 2: 32,274,901 (GRCm39) probably benign Het
Lonp2 A G 8: 87,364,619 (GRCm39) T326A possibly damaging Het
Lrpprc T C 17: 85,047,506 (GRCm39) I909V possibly damaging Het
Lrrc14 G T 15: 76,598,552 (GRCm39) R396L probably benign Het
Lypd6 T G 2: 50,055,679 (GRCm39) probably benign Het
Man2b1 A G 8: 85,819,645 (GRCm39) N610S probably damaging Het
Map2 A T 1: 66,453,987 (GRCm39) N959I probably benign Het
Mctp2 C T 7: 71,740,012 (GRCm39) V793I possibly damaging Het
Med25 A C 7: 44,529,982 (GRCm39) probably benign Het
Mfsd6 T C 1: 52,748,616 (GRCm39) Y83C probably damaging Het
Mtbp A T 15: 55,488,820 (GRCm39) M499L probably damaging Het
Mtmr10 A T 7: 63,947,245 (GRCm39) K53N probably damaging Het
Nfat5 T C 8: 108,085,333 (GRCm39) I542T probably damaging Het
Nr1h3 A G 2: 91,022,358 (GRCm39) M90T probably damaging Het
Nsmce4a A G 7: 130,147,623 (GRCm39) probably benign Het
Oprl1 G A 2: 181,361,021 (GRCm39) C318Y probably benign Het
Or5d40 T A 2: 88,015,854 (GRCm39) I211N possibly damaging Het
Pbx3 A T 2: 34,114,572 (GRCm39) S46T probably benign Het
Pign A T 1: 105,516,818 (GRCm39) F575I possibly damaging Het
Ptpn13 G T 5: 103,713,091 (GRCm39) S1738I probably benign Het
Rnf126 G T 10: 79,595,057 (GRCm39) P269Q probably damaging Het
Ryr3 G A 2: 112,477,468 (GRCm39) probably benign Het
Slc2a7 C T 4: 150,233,978 (GRCm39) A31V probably damaging Het
Slc6a12 A G 6: 121,340,218 (GRCm39) D487G probably damaging Het
Son G T 16: 91,453,032 (GRCm39) G593V probably damaging Het
Spata31d1a T C 13: 59,850,964 (GRCm39) N388S probably benign Het
Spg11 A T 2: 121,922,668 (GRCm39) M927K possibly damaging Het
Taf13 A G 3: 108,479,038 (GRCm39) M1V probably null Het
Trim32 G A 4: 65,531,491 (GRCm39) R16Q probably damaging Het
Trio A G 15: 27,902,603 (GRCm39) F286S probably damaging Het
Trpm2 A C 10: 77,779,824 (GRCm39) probably benign Het
Ttc7b T C 12: 100,353,438 (GRCm39) M390V possibly damaging Het
Vmn1r184 A T 7: 25,966,968 (GRCm39) Q238L probably damaging Het
Zfp236 T C 18: 82,676,213 (GRCm39) E368G probably damaging Het
Other mutations in Zfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfr2 APN 10 81,077,919 (GRCm39) missense probably damaging 0.96
IGL01622:Zfr2 APN 10 81,087,193 (GRCm39) missense probably benign
IGL01623:Zfr2 APN 10 81,087,193 (GRCm39) missense probably benign
IGL02719:Zfr2 APN 10 81,080,546 (GRCm39) missense probably damaging 1.00
IGL03036:Zfr2 APN 10 81,077,985 (GRCm39) missense probably benign 0.01
R0837:Zfr2 UTSW 10 81,081,242 (GRCm39) missense probably damaging 1.00
R1557:Zfr2 UTSW 10 81,083,225 (GRCm39) missense probably benign 0.01
R1714:Zfr2 UTSW 10 81,080,583 (GRCm39) missense probably damaging 1.00
R1737:Zfr2 UTSW 10 81,077,919 (GRCm39) missense probably damaging 0.96
R1991:Zfr2 UTSW 10 81,078,686 (GRCm39) missense possibly damaging 0.86
R2134:Zfr2 UTSW 10 81,078,735 (GRCm39) missense probably damaging 1.00
R2148:Zfr2 UTSW 10 81,077,950 (GRCm39) missense probably benign 0.13
R2150:Zfr2 UTSW 10 81,077,950 (GRCm39) missense probably benign 0.13
R3703:Zfr2 UTSW 10 81,081,913 (GRCm39) missense probably benign 0.40
R3704:Zfr2 UTSW 10 81,081,913 (GRCm39) missense probably benign 0.40
R3705:Zfr2 UTSW 10 81,081,913 (GRCm39) missense probably benign 0.40
R3715:Zfr2 UTSW 10 81,081,913 (GRCm39) missense probably benign 0.40
R4301:Zfr2 UTSW 10 81,078,018 (GRCm39) unclassified probably benign
R4654:Zfr2 UTSW 10 81,087,083 (GRCm39) splice site probably null
R4811:Zfr2 UTSW 10 81,079,547 (GRCm39) missense probably benign 0.07
R5290:Zfr2 UTSW 10 81,082,544 (GRCm39) frame shift probably null
R5781:Zfr2 UTSW 10 81,079,547 (GRCm39) missense probably benign 0.07
R7114:Zfr2 UTSW 10 81,080,559 (GRCm39) missense probably damaging 1.00
R8192:Zfr2 UTSW 10 81,078,649 (GRCm39) missense possibly damaging 0.83
R8359:Zfr2 UTSW 10 81,078,653 (GRCm39) missense possibly damaging 0.57
R8389:Zfr2 UTSW 10 81,081,323 (GRCm39) missense probably benign
R8827:Zfr2 UTSW 10 81,078,619 (GRCm39) missense probably benign 0.00
R8953:Zfr2 UTSW 10 81,084,271 (GRCm39) missense probably damaging 0.99
R9086:Zfr2 UTSW 10 81,076,029 (GRCm39) missense probably damaging 0.96
R9189:Zfr2 UTSW 10 81,080,496 (GRCm39) missense probably damaging 1.00
R9487:Zfr2 UTSW 10 81,075,969 (GRCm39) missense probably benign 0.33
R9592:Zfr2 UTSW 10 81,069,580 (GRCm39) missense unknown
R9645:Zfr2 UTSW 10 81,084,252 (GRCm39) nonsense probably null
X0063:Zfr2 UTSW 10 81,078,791 (GRCm39) critical splice donor site probably null
Z1177:Zfr2 UTSW 10 81,081,918 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGTTCCTCTACCCAGGAAGTACAG -3'
(R):5'- GAGGAGGCAATTCAGATCCCATTCAC -3'

Sequencing Primer
(F):5'- AGCTGGTGGTGACATTCCC -3'
(R):5'- CCAAGGAGATCACTGCTATCTGG -3'
Posted On 2013-04-16